\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218107426:

Variant ID: vg1218107426 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18107426
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCGTCTATTCCCCTACGCTTGCTTGCTTGATTGATCCGCCTCGTTGTCTCATCGGGAGAGAGGCATTGGTGATGGGGATCGATTAAAAACCGTGGTGGGA[C/T]
GACATGCTATGGTAGACATAGCTGCGGCCATATTTGTTGGCCAAGTTCTAGATGGCAGGGGTGTAGCAGAACCTGGCCATTGAGGACCAGCGCAGGTTCT

Reverse complement sequence

AGAACCTGCGCTGGTCCTCAATGGCCAGGTTCTGCTACACCCCTGCCATCTAGAACTTGGCCAACAAATATGGCCGCAGCTATGTCTACCATAGCATGTC[G/A]
TCCCACCACGGTTTTTAATCGATCCCCATCACCAATGCCTCTCTCCCGATGAGACAACGAGGCGGATCAATCAAGCAAGCAAGCGTAGGGGAATAGACGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.70% 8.20% 4.72% 0.38% NA
All Indica  2759 95.80% 1.40% 2.75% 0.07% NA
All Japonica  1512 68.10% 22.00% 8.93% 1.06% NA
Aus  269 95.50% 2.60% 1.86% 0.00% NA
Indica I  595 92.80% 2.20% 5.04% 0.00% NA
Indica II  465 99.10% 0.40% 0.43% 0.00% NA
Indica III  913 95.70% 1.00% 3.18% 0.11% NA
Indica Intermediate  786 96.10% 1.90% 1.91% 0.13% NA
Temperate Japonica  767 87.00% 6.10% 6.39% 0.52% NA
Tropical Japonica  504 38.50% 46.60% 12.90% 1.98% NA
Japonica Intermediate  241 69.70% 20.70% 8.71% 0.83% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 82.20% 10.00% 7.78% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218107426 C -> DEL N N silent_mutation Average:30.146; most accessible tissue: Minghui63 root, score: 45.031 N N N N
vg1218107426 C -> T LOC_Os12g30160.1 upstream_gene_variant ; 1446.0bp to feature; MODIFIER silent_mutation Average:30.146; most accessible tissue: Minghui63 root, score: 45.031 N N N N
vg1218107426 C -> T LOC_Os12g30170.1 upstream_gene_variant ; 3739.0bp to feature; MODIFIER silent_mutation Average:30.146; most accessible tissue: Minghui63 root, score: 45.031 N N N N
vg1218107426 C -> T LOC_Os12g30150-LOC_Os12g30160 intergenic_region ; MODIFIER silent_mutation Average:30.146; most accessible tissue: Minghui63 root, score: 45.031 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218107426 NA 8.17E-06 mr1124 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218107426 1.03E-06 NA mr1457_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218107426 9.28E-07 NA mr1458_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218107426 NA 3.43E-06 mr1758_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251