\
| Variant ID: vg1218107426 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18107426 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCGTCTATTCCCCTACGCTTGCTTGCTTGATTGATCCGCCTCGTTGTCTCATCGGGAGAGAGGCATTGGTGATGGGGATCGATTAAAAACCGTGGTGGGA[C/T]
GACATGCTATGGTAGACATAGCTGCGGCCATATTTGTTGGCCAAGTTCTAGATGGCAGGGGTGTAGCAGAACCTGGCCATTGAGGACCAGCGCAGGTTCT
AGAACCTGCGCTGGTCCTCAATGGCCAGGTTCTGCTACACCCCTGCCATCTAGAACTTGGCCAACAAATATGGCCGCAGCTATGTCTACCATAGCATGTC[G/A]
TCCCACCACGGTTTTTAATCGATCCCCATCACCAATGCCTCTCTCCCGATGAGACAACGAGGCGGATCAATCAAGCAAGCAAGCGTAGGGGAATAGACGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.70% | 8.20% | 4.72% | 0.38% | NA |
| All Indica | 2759 | 95.80% | 1.40% | 2.75% | 0.07% | NA |
| All Japonica | 1512 | 68.10% | 22.00% | 8.93% | 1.06% | NA |
| Aus | 269 | 95.50% | 2.60% | 1.86% | 0.00% | NA |
| Indica I | 595 | 92.80% | 2.20% | 5.04% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.40% | 0.43% | 0.00% | NA |
| Indica III | 913 | 95.70% | 1.00% | 3.18% | 0.11% | NA |
| Indica Intermediate | 786 | 96.10% | 1.90% | 1.91% | 0.13% | NA |
| Temperate Japonica | 767 | 87.00% | 6.10% | 6.39% | 0.52% | NA |
| Tropical Japonica | 504 | 38.50% | 46.60% | 12.90% | 1.98% | NA |
| Japonica Intermediate | 241 | 69.70% | 20.70% | 8.71% | 0.83% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 10.00% | 7.78% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218107426 | C -> DEL | N | N | silent_mutation | Average:30.146; most accessible tissue: Minghui63 root, score: 45.031 | N | N | N | N |
| vg1218107426 | C -> T | LOC_Os12g30160.1 | upstream_gene_variant ; 1446.0bp to feature; MODIFIER | silent_mutation | Average:30.146; most accessible tissue: Minghui63 root, score: 45.031 | N | N | N | N |
| vg1218107426 | C -> T | LOC_Os12g30170.1 | upstream_gene_variant ; 3739.0bp to feature; MODIFIER | silent_mutation | Average:30.146; most accessible tissue: Minghui63 root, score: 45.031 | N | N | N | N |
| vg1218107426 | C -> T | LOC_Os12g30150-LOC_Os12g30160 | intergenic_region ; MODIFIER | silent_mutation | Average:30.146; most accessible tissue: Minghui63 root, score: 45.031 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218107426 | NA | 8.17E-06 | mr1124 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218107426 | 1.03E-06 | NA | mr1457_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218107426 | 9.28E-07 | NA | mr1458_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218107426 | NA | 3.43E-06 | mr1758_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |