\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218104899:

Variant ID: vg1218104899 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18104899
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.02, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


ATATAGTGCTCAGATTTATAATATAATGATTTCTTTCACCTATATGAATAAATAGTACAAAATCCAAATACGACATAACACGATACATTATAATTATTCT[G/A]
TAATCAACTCTCGATTTCAGCTTAAACAGAGCTAAATGTTAGAAAAAACACAACCCACAGTGTTTAATTCTTCTCTCGCTACATCATACCTTTAATTTTC

Reverse complement sequence

GAAAATTAAAGGTATGATGTAGCGAGAGAAGAATTAAACACTGTGGGTTGTGTTTTTTCTAACATTTAGCTCTGTTTAAGCTGAAATCGAGAGTTGATTA[C/T]
AGAATAATTATAATGTATCGTGTTATGTCGTATTTGGATTTTGTACTATTTATTCATATAGGTGAAAGAAATCATTATATTATAAATCTGAGCACTATAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.60% 28.60% 4.13% 2.75% NA
All Indica  2759 50.90% 39.30% 5.15% 4.68% NA
All Japonica  1512 87.10% 11.80% 1.06% 0.07% NA
Aus  269 63.20% 24.20% 12.64% 0.00% NA
Indica I  595 11.80% 80.20% 5.04% 3.03% NA
Indica II  465 68.00% 21.70% 5.59% 4.73% NA
Indica III  913 64.40% 23.40% 4.93% 7.23% NA
Indica Intermediate  786 54.60% 37.30% 5.22% 2.93% NA
Temperate Japonica  767 98.70% 0.50% 0.65% 0.13% NA
Tropical Japonica  504 76.20% 22.80% 0.99% 0.00% NA
Japonica Intermediate  241 73.00% 24.50% 2.49% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 78.90% 17.80% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218104899 G -> DEL N N silent_mutation Average:9.49; most accessible tissue: Callus, score: 23.647 N N N N
vg1218104899 G -> A LOC_Os12g30160.1 upstream_gene_variant ; 3973.0bp to feature; MODIFIER silent_mutation Average:9.49; most accessible tissue: Callus, score: 23.647 N N N N
vg1218104899 G -> A LOC_Os12g30150.1 downstream_gene_variant ; 3062.0bp to feature; MODIFIER silent_mutation Average:9.49; most accessible tissue: Callus, score: 23.647 N N N N
vg1218104899 G -> A LOC_Os12g30150-LOC_Os12g30160 intergenic_region ; MODIFIER silent_mutation Average:9.49; most accessible tissue: Callus, score: 23.647 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218104899 NA 3.08E-06 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218104899 NA 1.17E-06 mr1139 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218104899 1.35E-06 1.07E-08 mr1155 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218104899 NA 4.82E-09 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218104899 NA 5.09E-07 mr1227 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218104899 NA 4.70E-08 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218104899 NA 6.99E-06 mr1291 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218104899 NA 2.43E-06 mr1335 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218104899 NA 3.46E-06 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218104899 NA 1.12E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218104899 NA 3.33E-07 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218104899 NA 5.62E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218104899 6.25E-06 NA mr1519 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218104899 NA 3.74E-06 mr1559 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218104899 NA 4.33E-06 mr1590 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218104899 NA 7.83E-07 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218104899 NA 4.61E-10 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218104899 NA 1.58E-06 mr1660 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218104899 NA 1.70E-06 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218104899 NA 3.45E-06 mr1755 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218104899 NA 3.44E-06 mr1755 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218104899 NA 3.20E-06 mr1958 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218104899 NA 1.00E-05 mr1958 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251