\
| Variant ID: vg1218085065 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18085065 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.83, G: 0.16, others allele: 0.00, population size: 99. )
ACCTCCGGTACCAAACATGATAACCCATAGGTATTATCAGCCTCATTGGATGGCATATTATATGAATATGCCAAATGGCATACTTATAAACGAAAATCAA[G/T]
TTGTGAATAAAACTTTTATATATGTGTTTTTAGCGATCCAAAAGTAAAGGCTGAAAAATAAACTTCGATGAAAAAACCCCAAAATCAGCTCCAAATTTAA
TTAAATTTGGAGCTGATTTTGGGGTTTTTTCATCGAAGTTTATTTTTCAGCCTTTACTTTTGGATCGCTAAAAACACATATATAAAAGTTTTATTCACAA[C/A]
TTGATTTTCGTTTATAAGTATGCCATTTGGCATATTCATATAATATGCCATCCAATGAGGCTGATAATACCTATGGGTTATCATGTTTGGTACCGGAGGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.20% | 47.60% | 0.08% | 4.15% | NA |
| All Indica | 2759 | 46.40% | 52.00% | 0.00% | 1.59% | NA |
| All Japonica | 1512 | 54.70% | 45.20% | 0.00% | 0.13% | NA |
| Aus | 269 | 23.80% | 30.10% | 0.37% | 45.72% | NA |
| Indica I | 595 | 5.40% | 94.50% | 0.00% | 0.17% | NA |
| Indica II | 465 | 68.60% | 30.30% | 0.00% | 1.08% | NA |
| Indica III | 913 | 64.30% | 33.40% | 0.00% | 2.30% | NA |
| Indica Intermediate | 786 | 43.50% | 54.30% | 0.00% | 2.16% | NA |
| Temperate Japonica | 767 | 35.20% | 64.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 77.60% | 22.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 68.90% | 30.30% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 72.90% | 8.30% | 0.00% | 18.75% | NA |
| Intermediate | 90 | 40.00% | 46.70% | 3.33% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218085065 | G -> DEL | N | N | silent_mutation | Average:45.629; most accessible tissue: Callus, score: 70.699 | N | N | N | N |
| vg1218085065 | G -> T | LOC_Os12g30130-LOC_Os12g30140 | intergenic_region ; MODIFIER | silent_mutation | Average:45.629; most accessible tissue: Callus, score: 70.699 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218085065 | NA | 8.74E-06 | mr1010 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218085065 | NA | 4.58E-06 | mr1060 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218085065 | NA | 2.88E-08 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218085065 | NA | 5.33E-06 | mr1170 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218085065 | NA | 6.59E-06 | mr1188 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218085065 | NA | 7.49E-07 | mr1192 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218085065 | NA | 6.74E-06 | mr1280 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218085065 | NA | 7.76E-06 | mr1353 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218085065 | NA | 9.36E-06 | mr1359 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218085065 | NA | 1.70E-07 | mr1397 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218085065 | NA | 5.21E-09 | mr1486 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218085065 | NA | 3.46E-06 | mr1548 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218085065 | NA | 1.11E-07 | mr1557 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218085065 | NA | 8.77E-09 | mr1857 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218085065 | NA | 5.63E-06 | mr1857 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218085065 | NA | 8.86E-06 | mr1232_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218085065 | NA | 8.03E-09 | mr1557_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218085065 | NA | 4.24E-09 | mr1565_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218085065 | NA | 1.22E-09 | mr1598_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |