| Variant ID: vg1218056766 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18056766 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AAATAATCAAAGTTATGGAACATGATAAGTACTGGTACCGAAAGATATCTCAAAATCTTTTTTTATCACGATACAATAATAAAATAGGTCAAAGCAAAAA[T/A]
GAATGTTTCTCGGACTACTACTTTGAGTTTACAGACAAGAAAACATTATGGGGCAGAAAGAACGAAGATCAACAGTTATGAGGTATGTGTTTAATATTGC
GCAATATTAAACACATACCTCATAACTGTTGATCTTCGTTCTTTCTGCCCCATAATGTTTTCTTGTCTGTAAACTCAAAGTAGTAGTCCGAGAAACATTC[A/T]
TTTTTGCTTTGACCTATTTTATTATTGTATCGTGATAAAAAAAGATTTTGAGATATCTTTCGGTACCAGTACTTATCATGTTCCATAACTTTGATTATTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.90% | 0.20% | 3.20% | 17.67% | NA |
| All Indica | 2759 | 93.10% | 0.30% | 4.71% | 1.88% | NA |
| All Japonica | 1512 | 52.50% | 0.00% | 1.06% | 46.43% | NA |
| Aus | 269 | 94.10% | 0.00% | 0.00% | 5.95% | NA |
| Indica I | 595 | 94.50% | 0.50% | 3.36% | 1.68% | NA |
| Indica II | 465 | 82.40% | 0.40% | 16.77% | 0.43% | NA |
| Indica III | 913 | 97.60% | 0.00% | 0.66% | 1.75% | NA |
| Indica Intermediate | 786 | 93.10% | 0.50% | 3.31% | 3.05% | NA |
| Temperate Japonica | 767 | 67.40% | 0.00% | 0.65% | 31.94% | NA |
| Tropical Japonica | 504 | 28.40% | 0.00% | 1.59% | 70.04% | NA |
| Japonica Intermediate | 241 | 55.60% | 0.00% | 1.24% | 43.15% | NA |
| VI/Aromatic | 96 | 43.80% | 0.00% | 2.08% | 54.17% | NA |
| Intermediate | 90 | 82.20% | 0.00% | 3.33% | 14.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218056766 | T -> DEL | N | N | silent_mutation | Average:13.46; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| vg1218056766 | T -> A | LOC_Os12g30120-LOC_Os12g30130 | intergenic_region ; MODIFIER | silent_mutation | Average:13.46; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218056766 | NA | 2.30E-06 | mr1188 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218056766 | NA | 4.62E-09 | mr1458 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218056766 | NA | 2.31E-06 | mr1754 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218056766 | 1.41E-06 | NA | mr1458_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218056766 | 5.05E-06 | 2.61E-11 | mr1458_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |