\
| Variant ID: vg1218047316 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18047316 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 309. )
CACCTCATTCCCAACTCCCCTTTCCACAATCTCCATTTCAGCCTCACCAACTTTAGTGTGTACCTTGCCCCATTCGACCATACGACTTAATTCAGCTGCA[G/A]
AAGAACGAAAAGTCCCATCACCATTATCATGCACCACCCACTTCCATCTACCAGGTATGAACCTCTCCAACTCAGAAATAATAGAACTTACAGACATCTG
CAGATGTCTGTAAGTTCTATTATTTCTGAGTTGGAGAGGTTCATACCTGGTAGATGGAAGTGGGTGGTGCATGATAATGGTGATGGGACTTTTCGTTCTT[C/T]
TGCAGCTGAATTAAGTCGTATGGTCGAATGGGGCAAGGTACACACTAAAGTTGGTGAGGCTGAAATGGAGATTGTGGAAAGGGGAGTTGGGAATGAGGTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.00% | 5.60% | 0.00% | 0.42% | NA |
| All Indica | 2759 | 91.40% | 7.90% | 0.00% | 0.72% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 84.80% | 15.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
| Indica II | 465 | 94.20% | 5.40% | 0.00% | 0.43% | NA |
| Indica III | 913 | 90.60% | 7.60% | 0.00% | 1.86% | NA |
| Indica Intermediate | 786 | 89.40% | 10.40% | 0.00% | 0.13% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218047316 | G -> DEL | LOC_Os12g30120.1 | N | frameshift_variant | Average:36.108; most accessible tissue: Minghui63 young leaf, score: 53.016 | N | N | N | N |
| vg1218047316 | G -> A | LOC_Os12g30120.1 | missense_variant ; p.Ser182Phe; MODERATE | nonsynonymous_codon ; S182F | Average:36.108; most accessible tissue: Minghui63 young leaf, score: 53.016 | unknown | unknown | TOLERATED | 0.59 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218047316 | 1.21E-06 | NA | mr1321 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218047316 | 3.86E-08 | 3.86E-08 | mr1321 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218047316 | 2.71E-06 | 2.71E-06 | mr1323 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218047316 | 2.44E-06 | 6.46E-07 | mr1324 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218047316 | 8.15E-06 | NA | mr1325 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218047316 | 5.35E-06 | 1.14E-06 | mr1325 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218047316 | NA | 6.54E-06 | mr1326 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218047316 | NA | 8.47E-06 | mr1335 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218047316 | 8.96E-06 | NA | mr1336 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218047316 | NA | 1.56E-06 | mr1336 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218047316 | 2.55E-06 | 3.03E-06 | mr1621 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218047316 | 3.80E-06 | NA | mr1873 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |