\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218040492:

Variant ID: vg1218040492 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18040492
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 331. )

Flanking Sequence (100 bp) in Reference Genome:


CCAAACAACTCAGTGTAGATCAATAGCCGTTAGAACAGCTGGTGCTTTGACCTGCAGACATTGTAGATGATGTATAGGAAAAGCAAGACAAGCTTGCAAG[T/C]
TGGCCAGATGTCATTGTCTTTTTCTAGCATTGCACAAATTGGATCAATAGTCTGAACTACGCAAGAGGCACTTCCCCTTTAACAAACTTTATCCGTGGAA

Reverse complement sequence

TTCCACGGATAAAGTTTGTTAAAGGGGAAGTGCCTCTTGCGTAGTTCAGACTATTGATCCAATTTGTGCAATGCTAGAAAAAGACAATGACATCTGGCCA[A/G]
CTTGCAAGCTTGTCTTGCTTTTCCTATACATCATCTACAATGTCTGCAGGTCAAAGCACCAGCTGTTCTAACGGCTATTGATCTACACTGAGTTGTTTGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.40% 4.70% 0.08% 0.80% NA
All Indica  2759 90.60% 7.90% 0.14% 1.38% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 92.90% 6.90% 0.17% 0.00% NA
Indica II  465 93.10% 5.40% 0.00% 1.51% NA
Indica III  913 90.30% 7.70% 0.11% 1.97% NA
Indica Intermediate  786 87.70% 10.40% 0.25% 1.65% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218040492 T -> C LOC_Os12g30110.1 upstream_gene_variant ; 1536.0bp to feature; MODIFIER silent_mutation Average:65.797; most accessible tissue: Callus, score: 86.578 N N N N
vg1218040492 T -> C LOC_Os12g30120.1 downstream_gene_variant ; 1992.0bp to feature; MODIFIER silent_mutation Average:65.797; most accessible tissue: Callus, score: 86.578 N N N N
vg1218040492 T -> C LOC_Os12g30110-LOC_Os12g30120 intergenic_region ; MODIFIER silent_mutation Average:65.797; most accessible tissue: Callus, score: 86.578 N N N N
vg1218040492 T -> DEL N N silent_mutation Average:65.797; most accessible tissue: Callus, score: 86.578 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218040492 2.62E-06 NA mr1265 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218040492 6.15E-06 7.69E-06 mr1320 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218040492 2.10E-09 2.10E-09 mr1321 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218040492 4.80E-07 4.80E-07 mr1323 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218040492 1.83E-06 4.93E-07 mr1324 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218040492 5.62E-06 1.14E-06 mr1325 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218040492 NA 4.60E-06 mr1326 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218040492 NA 4.01E-06 mr1335 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218040492 NA 1.90E-06 mr1336 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218040492 6.48E-07 NA mr1439 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218040492 3.95E-06 3.95E-06 mr1462 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218040492 3.71E-06 3.71E-06 mr1545 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218040492 NA 8.27E-06 mr1579 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218040492 1.62E-06 1.60E-06 mr1621 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218040492 1.25E-06 1.75E-06 mr1712 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251