\
| Variant ID: vg1218040492 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18040492 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 331. )
CCAAACAACTCAGTGTAGATCAATAGCCGTTAGAACAGCTGGTGCTTTGACCTGCAGACATTGTAGATGATGTATAGGAAAAGCAAGACAAGCTTGCAAG[T/C]
TGGCCAGATGTCATTGTCTTTTTCTAGCATTGCACAAATTGGATCAATAGTCTGAACTACGCAAGAGGCACTTCCCCTTTAACAAACTTTATCCGTGGAA
TTCCACGGATAAAGTTTGTTAAAGGGGAAGTGCCTCTTGCGTAGTTCAGACTATTGATCCAATTTGTGCAATGCTAGAAAAAGACAATGACATCTGGCCA[A/G]
CTTGCAAGCTTGTCTTGCTTTTCCTATACATCATCTACAATGTCTGCAGGTCAAAGCACCAGCTGTTCTAACGGCTATTGATCTACACTGAGTTGTTTGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.40% | 4.70% | 0.08% | 0.80% | NA |
| All Indica | 2759 | 90.60% | 7.90% | 0.14% | 1.38% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 92.90% | 6.90% | 0.17% | 0.00% | NA |
| Indica II | 465 | 93.10% | 5.40% | 0.00% | 1.51% | NA |
| Indica III | 913 | 90.30% | 7.70% | 0.11% | 1.97% | NA |
| Indica Intermediate | 786 | 87.70% | 10.40% | 0.25% | 1.65% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218040492 | T -> C | LOC_Os12g30110.1 | upstream_gene_variant ; 1536.0bp to feature; MODIFIER | silent_mutation | Average:65.797; most accessible tissue: Callus, score: 86.578 | N | N | N | N |
| vg1218040492 | T -> C | LOC_Os12g30120.1 | downstream_gene_variant ; 1992.0bp to feature; MODIFIER | silent_mutation | Average:65.797; most accessible tissue: Callus, score: 86.578 | N | N | N | N |
| vg1218040492 | T -> C | LOC_Os12g30110-LOC_Os12g30120 | intergenic_region ; MODIFIER | silent_mutation | Average:65.797; most accessible tissue: Callus, score: 86.578 | N | N | N | N |
| vg1218040492 | T -> DEL | N | N | silent_mutation | Average:65.797; most accessible tissue: Callus, score: 86.578 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218040492 | 2.62E-06 | NA | mr1265 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218040492 | 6.15E-06 | 7.69E-06 | mr1320 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218040492 | 2.10E-09 | 2.10E-09 | mr1321 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218040492 | 4.80E-07 | 4.80E-07 | mr1323 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218040492 | 1.83E-06 | 4.93E-07 | mr1324 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218040492 | 5.62E-06 | 1.14E-06 | mr1325 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218040492 | NA | 4.60E-06 | mr1326 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218040492 | NA | 4.01E-06 | mr1335 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218040492 | NA | 1.90E-06 | mr1336 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218040492 | 6.48E-07 | NA | mr1439 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218040492 | 3.95E-06 | 3.95E-06 | mr1462 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218040492 | 3.71E-06 | 3.71E-06 | mr1545 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218040492 | NA | 8.27E-06 | mr1579 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218040492 | 1.62E-06 | 1.60E-06 | mr1621 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218040492 | 1.25E-06 | 1.75E-06 | mr1712 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |