Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1218040492:

Variant ID: vg1218040492 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 18040492
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 331. )

Flanking Sequence (100 bp) in Reference Genome:

CCAAACAACTCAGTGTAGATCAATAGCCGTTAGAACAGCTGGTGCTTTGACCTGCAGACATTGTAGATGATGTATAGGAAAAGCAAGACAAGCTTGCAAG[T/C]
TGGCCAGATGTCATTGTCTTTTTCTAGCATTGCACAAATTGGATCAATAGTCTGAACTACGCAAGAGGCACTTCCCCTTTAACAAACTTTATCCGTGGAA

Reverse complement sequence

TTCCACGGATAAAGTTTGTTAAAGGGGAAGTGCCTCTTGCGTAGTTCAGACTATTGATCCAATTTGTGCAATGCTAGAAAAAGACAATGACATCTGGCCA[A/G]
CTTGCAAGCTTGTCTTGCTTTTCCTATACATCATCTACAATGTCTGCAGGTCAAAGCACCAGCTGTTCTAACGGCTATTGATCTACACTGAGTTGTTTGG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.40%	4.70%	0.08%	0.80%	NA
All Indica	2759	90.60%	7.90%	0.14%	1.38%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	92.90%	6.90%	0.17%	0.00%	NA
Indica II	465	93.10%	5.40%	0.00%	1.51%	NA
Indica III	913	90.30%	7.70%	0.11%	1.97%	NA
Indica Intermediate	786	87.70%	10.40%	0.25%	1.65%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1218040492	T -> C	LOC_Os12g30110.1	upstream_gene_variant ; 1536.0bp to feature; MODIFIER	silent_mutation	Average:65.797; most accessible tissue: Callus, score: 86.578	N	N	N	N
vg1218040492	T -> C	LOC_Os12g30120.1	downstream_gene_variant ; 1992.0bp to feature; MODIFIER	silent_mutation	Average:65.797; most accessible tissue: Callus, score: 86.578	N	N	N	N
vg1218040492	T -> C	LOC_Os12g30110-LOC_Os12g30120	intergenic_region ; MODIFIER	silent_mutation	Average:65.797; most accessible tissue: Callus, score: 86.578	N	N	N	N
vg1218040492	T -> DEL	N	N	silent_mutation	Average:65.797; most accessible tissue: Callus, score: 86.578	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1218040492	2.62E-06	NA	mr1265	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218040492	6.15E-06	7.69E-06	mr1320	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218040492	2.10E-09	2.10E-09	mr1321	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218040492	4.80E-07	4.80E-07	mr1323	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218040492	1.83E-06	4.93E-07	mr1324	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218040492	5.62E-06	1.14E-06	mr1325	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218040492	NA	4.60E-06	mr1326	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218040492	NA	4.01E-06	mr1335	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218040492	NA	1.90E-06	mr1336	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218040492	6.48E-07	NA	mr1439	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218040492	3.95E-06	3.95E-06	mr1462	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218040492	3.71E-06	3.71E-06	mr1545	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218040492	NA	8.27E-06	mr1579	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218040492	1.62E-06	1.60E-06	mr1621	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218040492	1.25E-06	1.75E-06	mr1712	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251