Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1218024420:

Variant ID: vg1218024420 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 18024420
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.71, G: 0.29, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:

GAAGAGTTATCTCAATCGGGCAAACGGCCGTCACGGATGAATCTATCTTAATCGTGCCCTAATTAAAGCCCGTCACCGATAGCTTTGACCCAGACGACTA[A/G]
TCAAACTATAGCCCGTCACAGATGACCTATCTCAATCGGGCCACAACTAGCGTTCGTCACAGATGACCCTTATCTGTGACGGGTATTAACTATAGCTCGT

Reverse complement sequence

ACGAGCTATAGTTAATACCCGTCACAGATAAGGGTCATCTGTGACGAACGCTAGTTGTGGCCCGATTGAGATAGGTCATCTGTGACGGGCTATAGTTTGA[T/C]
TAGTCGTCTGGGTCAAAGCTATCGGTGACGGGCTTTAATTAGGGCACGATTAAGATAGATTCATCCGTGACGGCCGTTTGCCCGATTGAGATAACTCTTC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	22.30%	18.90%	0.44%	58.29%	NA
All Indica	2759	12.30%	22.10%	0.51%	65.10%	NA
All Japonica	1512	44.80%	0.70%	0.20%	54.30%	NA
Aus	269	3.00%	84.80%	0.00%	12.27%	NA
Indica I	595	8.60%	21.00%	1.18%	69.24%	NA
Indica II	465	17.80%	10.10%	0.22%	71.83%	NA
Indica III	913	9.00%	33.00%	0.11%	57.94%	NA
Indica Intermediate	786	15.60%	17.40%	0.64%	66.28%	NA
Temperate Japonica	767	66.00%	0.30%	0.13%	33.64%	NA
Tropical Japonica	504	22.00%	0.40%	0.40%	77.18%	NA
Japonica Intermediate	241	25.30%	2.50%	0.00%	72.20%	NA
VI/Aromatic	96	4.20%	29.20%	0.00%	66.67%	NA
Intermediate	90	30.00%	20.00%	4.44%	45.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1218024420	A -> DEL	N	N	silent_mutation	Average:34.977; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg1218024420	A -> G	LOC_Os12g30080-LOC_Os12g30100	intergenic_region ; MODIFIER	silent_mutation	Average:34.977; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1218024420	NA	2.62E-08	mr1004	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218024420	NA	1.07E-08	mr1005	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218024420	3.00E-06	1.14E-12	mr1006	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218024420	4.43E-06	3.16E-11	mr1007	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218024420	1.62E-06	4.64E-13	mr1052	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218024420	NA	6.84E-06	mr1052	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218024420	NA	1.33E-06	mr1207	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218024420	NA	3.05E-10	mr1307	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218024420	NA	7.23E-08	mr1006_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218024420	NA	4.64E-06	mr1006_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251