\
| Variant ID: vg1218024420 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18024420 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.71, G: 0.29, others allele: 0.00, population size: 63. )
GAAGAGTTATCTCAATCGGGCAAACGGCCGTCACGGATGAATCTATCTTAATCGTGCCCTAATTAAAGCCCGTCACCGATAGCTTTGACCCAGACGACTA[A/G]
TCAAACTATAGCCCGTCACAGATGACCTATCTCAATCGGGCCACAACTAGCGTTCGTCACAGATGACCCTTATCTGTGACGGGTATTAACTATAGCTCGT
ACGAGCTATAGTTAATACCCGTCACAGATAAGGGTCATCTGTGACGAACGCTAGTTGTGGCCCGATTGAGATAGGTCATCTGTGACGGGCTATAGTTTGA[T/C]
TAGTCGTCTGGGTCAAAGCTATCGGTGACGGGCTTTAATTAGGGCACGATTAAGATAGATTCATCCGTGACGGCCGTTTGCCCGATTGAGATAACTCTTC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 22.30% | 18.90% | 0.44% | 58.29% | NA |
| All Indica | 2759 | 12.30% | 22.10% | 0.51% | 65.10% | NA |
| All Japonica | 1512 | 44.80% | 0.70% | 0.20% | 54.30% | NA |
| Aus | 269 | 3.00% | 84.80% | 0.00% | 12.27% | NA |
| Indica I | 595 | 8.60% | 21.00% | 1.18% | 69.24% | NA |
| Indica II | 465 | 17.80% | 10.10% | 0.22% | 71.83% | NA |
| Indica III | 913 | 9.00% | 33.00% | 0.11% | 57.94% | NA |
| Indica Intermediate | 786 | 15.60% | 17.40% | 0.64% | 66.28% | NA |
| Temperate Japonica | 767 | 66.00% | 0.30% | 0.13% | 33.64% | NA |
| Tropical Japonica | 504 | 22.00% | 0.40% | 0.40% | 77.18% | NA |
| Japonica Intermediate | 241 | 25.30% | 2.50% | 0.00% | 72.20% | NA |
| VI/Aromatic | 96 | 4.20% | 29.20% | 0.00% | 66.67% | NA |
| Intermediate | 90 | 30.00% | 20.00% | 4.44% | 45.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218024420 | A -> DEL | N | N | silent_mutation | Average:34.977; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg1218024420 | A -> G | LOC_Os12g30080-LOC_Os12g30100 | intergenic_region ; MODIFIER | silent_mutation | Average:34.977; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218024420 | NA | 2.62E-08 | mr1004 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218024420 | NA | 1.07E-08 | mr1005 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218024420 | 3.00E-06 | 1.14E-12 | mr1006 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218024420 | 4.43E-06 | 3.16E-11 | mr1007 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218024420 | 1.62E-06 | 4.64E-13 | mr1052 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218024420 | NA | 6.84E-06 | mr1052 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218024420 | NA | 1.33E-06 | mr1207 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218024420 | NA | 3.05E-10 | mr1307 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218024420 | NA | 7.23E-08 | mr1006_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218024420 | NA | 4.64E-06 | mr1006_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |