\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218024420:

Variant ID: vg1218024420 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18024420
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.71, G: 0.29, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


GAAGAGTTATCTCAATCGGGCAAACGGCCGTCACGGATGAATCTATCTTAATCGTGCCCTAATTAAAGCCCGTCACCGATAGCTTTGACCCAGACGACTA[A/G]
TCAAACTATAGCCCGTCACAGATGACCTATCTCAATCGGGCCACAACTAGCGTTCGTCACAGATGACCCTTATCTGTGACGGGTATTAACTATAGCTCGT

Reverse complement sequence

ACGAGCTATAGTTAATACCCGTCACAGATAAGGGTCATCTGTGACGAACGCTAGTTGTGGCCCGATTGAGATAGGTCATCTGTGACGGGCTATAGTTTGA[T/C]
TAGTCGTCTGGGTCAAAGCTATCGGTGACGGGCTTTAATTAGGGCACGATTAAGATAGATTCATCCGTGACGGCCGTTTGCCCGATTGAGATAACTCTTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 22.30% 18.90% 0.44% 58.29% NA
All Indica  2759 12.30% 22.10% 0.51% 65.10% NA
All Japonica  1512 44.80% 0.70% 0.20% 54.30% NA
Aus  269 3.00% 84.80% 0.00% 12.27% NA
Indica I  595 8.60% 21.00% 1.18% 69.24% NA
Indica II  465 17.80% 10.10% 0.22% 71.83% NA
Indica III  913 9.00% 33.00% 0.11% 57.94% NA
Indica Intermediate  786 15.60% 17.40% 0.64% 66.28% NA
Temperate Japonica  767 66.00% 0.30% 0.13% 33.64% NA
Tropical Japonica  504 22.00% 0.40% 0.40% 77.18% NA
Japonica Intermediate  241 25.30% 2.50% 0.00% 72.20% NA
VI/Aromatic  96 4.20% 29.20% 0.00% 66.67% NA
Intermediate  90 30.00% 20.00% 4.44% 45.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218024420 A -> DEL N N silent_mutation Average:34.977; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg1218024420 A -> G LOC_Os12g30080-LOC_Os12g30100 intergenic_region ; MODIFIER silent_mutation Average:34.977; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218024420 NA 2.62E-08 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218024420 NA 1.07E-08 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218024420 3.00E-06 1.14E-12 mr1006 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218024420 4.43E-06 3.16E-11 mr1007 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218024420 1.62E-06 4.64E-13 mr1052 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218024420 NA 6.84E-06 mr1052 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218024420 NA 1.33E-06 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218024420 NA 3.05E-10 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218024420 NA 7.23E-08 mr1006_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218024420 NA 4.64E-06 mr1006_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251