\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218022533:

Variant ID: vg1218022533 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 18022533
Reference Allele: CCTTAlternative Allele: ACTT,C,GCTT
Primary Allele: CCTTSecondary Allele: ACTT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAATTCTATAGGTAAGTTGCTTTAAAAAAAAGCATATTAATCCATTTTTAAAATTTAAAATAAATAATACTCAAATAATCATGCGCTAATGATTCACCT[CCTT/ACTT,C,GCTT]
CTTTTTACGCATATTCTCAATCTTCTCTTTTCCTATTCTCTCAAACACTCGGATATTAGAAAAATCTGGCAATTAATTGATAGACCCTCAACTTCACAAT

Reverse complement sequence

ATTGTGAAGTTGAGGGTCTATCAATTAATTGCCAGATTTTTCTAATATCCGAGTGTTTGAGAGAATAGGAAAAGAGAAGATTGAGAATATGCGTAAAAAG[AAGG/AAGT,G,AAGC]
AGGTGAATCATTAGCGCATGATTATTTGAGTATTATTTATTTTAAATTTTAAAAATGGATTAATATGCTTTTTTTTAAAGCAACTTACCTATAGAATTTT

Allele Frequencies:

Populations Population SizeFrequency of CCTT(primary allele) Frequency of ACTT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.50% 38.60% 0.15% 0.00% C: 4.66%; GCTT: 0.06%
All Indica  2759 57.90% 34.10% 0.14% 0.00% C: 7.87%; GCTT: 0.04%
All Japonica  1512 49.90% 49.90% 0.07% 0.00% C: 0.07%
Aus  269 88.10% 11.90% 0.00% 0.00% NA
Indica I  595 82.00% 10.90% 0.17% 0.00% C: 6.89%
Indica II  465 53.80% 40.60% 0.22% 0.00% C: 5.38%
Indica III  913 50.80% 41.60% 0.11% 0.00% C: 7.45%
Indica Intermediate  786 50.30% 38.90% 0.13% 0.00% C: 10.56%; GCTT: 0.13%
Temperate Japonica  767 65.60% 34.30% 0.00% 0.00% C: 0.13%
Tropical Japonica  504 26.40% 73.60% 0.00% 0.00% NA
Japonica Intermediate  241 49.40% 50.20% 0.41% 0.00% NA
VI/Aromatic  96 33.30% 66.70% 0.00% 0.00% NA
Intermediate  90 55.60% 37.80% 2.22% 0.00% C: 2.22%; GCTT: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218022533 CCTT -> ACTT LOC_Os12g30080-LOC_Os12g30100 intergenic_region ; MODIFIER silent_mutation Average:49.078; most accessible tissue: Zhenshan97 flower, score: 89.858 N N N N
vg1218022533 CCTT -> C LOC_Os12g30080-LOC_Os12g30100 intergenic_region ; MODIFIER silent_mutation Average:49.078; most accessible tissue: Zhenshan97 flower, score: 89.858 N N N N
vg1218022533 CCTT -> GCTT LOC_Os12g30080-LOC_Os12g30100 intergenic_region ; MODIFIER silent_mutation Average:49.078; most accessible tissue: Zhenshan97 flower, score: 89.858 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1218022533 CCTT ACTT 0.04 0.0 -0.01 -0.01 0.0 0.0
vg1218022533 CCTT C -0.16 0.08 0.06 -0.04 -0.03 -0.05
vg1218022533 CCTT GCTT 0.04 0.0 0.0 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218022533 NA 2.49E-06 mr1046 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218022533 NA 8.11E-06 mr1048 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218022533 4.19E-06 4.18E-06 mr1060 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218022533 NA 1.23E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218022533 NA 9.79E-06 mr1171 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218022533 NA 9.43E-06 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218022533 NA 1.10E-06 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218022533 NA 1.22E-06 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218022533 NA 2.53E-06 mr1288 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218022533 NA 5.10E-06 mr1318 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218022533 NA 2.41E-06 mr1353 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218022533 1.77E-07 1.77E-07 mr1356 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218022533 NA 4.06E-06 mr1397 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218022533 NA 2.47E-09 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218022533 NA 6.50E-07 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218022533 NA 7.20E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218022533 NA 2.09E-08 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218022533 NA 1.53E-06 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218022533 NA 5.50E-06 mr1820 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218022533 NA 3.25E-06 mr1902 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218022533 NA 9.00E-06 mr1912 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251