\
| Variant ID: vg1217835762 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 17835762 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGGGAACCAATGAAGCTTACCAATTGTTGGCGTCAGAAGAAAAAAAAACTACGCACAAAATTACTATAAAATCAATAAGAAAAAAAACATACGTACTTAG[T/A]
ACCATGCGAAAAAATTGATGATATTTAAAATAAGATTTTCTATTATTTAAAGATAAAGTTCATTAAACTTCCTATAAACGCTCTCAAGCCGCCACGTGAG
CTCACGTGGCGGCTTGAGAGCGTTTATAGGAAGTTTAATGAACTTTATCTTTAAATAATAGAAAATCTTATTTTAAATATCATCAATTTTTTCGCATGGT[A/T]
CTAAGTACGTATGTTTTTTTTCTTATTGATTTTATAGTAATTTTGTGCGTAGTTTTTTTTTCTTCTGACGCCAACAATTGGTAAGCTTCATTGGTTCCCT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.60% | 2.90% | 3.03% | 19.47% | NA |
| All Indica | 2759 | 82.90% | 0.30% | 1.41% | 15.40% | NA |
| All Japonica | 1512 | 60.60% | 7.30% | 6.22% | 25.86% | NA |
| Aus | 269 | 68.00% | 6.70% | 1.49% | 23.79% | NA |
| Indica I | 595 | 92.10% | 0.20% | 0.50% | 7.23% | NA |
| Indica II | 465 | 62.60% | 0.00% | 3.66% | 33.76% | NA |
| Indica III | 913 | 92.40% | 0.40% | 0.55% | 6.57% | NA |
| Indica Intermediate | 786 | 76.80% | 0.40% | 1.78% | 20.99% | NA |
| Temperate Japonica | 767 | 79.40% | 1.80% | 4.04% | 14.73% | NA |
| Tropical Japonica | 504 | 41.70% | 10.50% | 9.13% | 38.69% | NA |
| Japonica Intermediate | 241 | 40.70% | 17.80% | 7.05% | 34.44% | NA |
| VI/Aromatic | 96 | 70.80% | 0.00% | 4.17% | 25.00% | NA |
| Intermediate | 90 | 76.70% | 3.30% | 2.22% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1217835762 | T -> DEL | N | N | silent_mutation | Average:13.1; most accessible tissue: Zhenshan97 root, score: 22.162 | N | N | N | N |
| vg1217835762 | T -> A | LOC_Os12g29830-LOC_Os12g29840 | intergenic_region ; MODIFIER | silent_mutation | Average:13.1; most accessible tissue: Zhenshan97 root, score: 22.162 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1217835762 | 2.20E-06 | 1.02E-07 | mr1110_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217835762 | 3.51E-06 | 3.31E-07 | mr1112_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217835762 | NA | 2.90E-06 | mr1457_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217835762 | NA | 3.28E-07 | mr1458_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217835762 | NA | 6.38E-06 | mr1865_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |