\
| Variant ID: vg1217810691 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 17810691 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.10, others allele: 0.00, population size: 204. )
TTGGCGATGCTTGCCTCCGGACGAGCACGGATATGAACATACTTCTTTAGAACGCCCATGTACCTCTCGAAAGGAAACATGTTGTGTAGGTACACAGGCC[T/C]
GAAAATACCGATCTCTTTGACAAGGTGACAAAGCAGATGCGTCATTATATTGAAAAATGAAGGTGGAAATATCAACTCAAAGCTGACAAGACATTACACC
GGTGTAATGTCTTGTCAGCTTTGAGTTGATATTTCCACCTTCATTTTTCAATATAATGACGCATCTGCTTTGTCACCTTGTCAAAGAGATCGGTATTTTC[A/G]
GGCCTGTGTACCTACACAACATGTTTCCTTTCGAGAGGTACATGGGCGTTCTAAAGAAGTATGTTCATATCCGTGCTCGTCCGGAGGCAAGCATCGCCAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.20% | 29.50% | 0.91% | 34.43% | NA |
| All Indica | 2759 | 39.50% | 25.20% | 1.12% | 34.14% | NA |
| All Japonica | 1512 | 25.60% | 44.00% | 0.66% | 29.76% | NA |
| Aus | 269 | 43.10% | 1.50% | 0.37% | 55.02% | NA |
| Indica I | 595 | 46.90% | 44.00% | 0.34% | 8.74% | NA |
| Indica II | 465 | 18.50% | 23.00% | 2.37% | 56.13% | NA |
| Indica III | 913 | 40.00% | 17.50% | 1.10% | 41.40% | NA |
| Indica Intermediate | 786 | 45.90% | 21.10% | 1.02% | 31.93% | NA |
| Temperate Japonica | 767 | 21.80% | 74.20% | 0.13% | 3.91% | NA |
| Tropical Japonica | 504 | 34.90% | 4.60% | 1.19% | 59.33% | NA |
| Japonica Intermediate | 241 | 18.30% | 30.30% | 1.24% | 50.21% | NA |
| VI/Aromatic | 96 | 34.40% | 3.10% | 0.00% | 62.50% | NA |
| Intermediate | 90 | 40.00% | 28.90% | 1.11% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1217810691 | T -> C | LOC_Os12g29800.1 | missense_variant ; p.Arg135Gly; MODERATE | nonsynonymous_codon ; R135G | Average:23.56; most accessible tissue: Zhenshan97 root, score: 47.644 | unknown | unknown | TOLERATED | 1.00 |
| vg1217810691 | T -> DEL | LOC_Os12g29800.1 | N | frameshift_variant | Average:23.56; most accessible tissue: Zhenshan97 root, score: 47.644 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1217810691 | NA | 3.41E-20 | Plant_height | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1217810691 | NA | 1.81E-06 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217810691 | NA | 1.84E-06 | mr1180 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217810691 | NA | 1.71E-08 | mr1183 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217810691 | NA | 1.03E-07 | mr1503 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217810691 | NA | 7.75E-06 | mr1561 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217810691 | 4.37E-06 | NA | mr1824 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217810691 | NA | 6.21E-06 | mr1826 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217810691 | NA | 5.84E-08 | mr1063_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217810691 | NA | 1.41E-06 | mr1653_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217810691 | NA | 6.81E-06 | mr1844_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217810691 | NA | 2.29E-09 | mr1870_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |