\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217803999:

Variant ID: vg1217803999 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17803999
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


TTAGGATTATATACCGGCACGGAGGAATACCCGTATTGAGCTGTCACCATCAGCGGCCCACCTCTCATCCTCAATATATAACCCCAAATAATGATATCCC[A/G]
AAATCTAGACACCACGTCTAAACTACCAGATACTACTCTAATATCTTCGTCATGACATAGAGTAATTGCATAAGCAAACATTATACCCGCACCAAAGCAT

Reverse complement sequence

ATGCTTTGGTGCGGGTATAATGTTTGCTTATGCAATTACTCTATGTCATGACGAAGATATTAGAGTAGTATCTGGTAGTTTAGACGTGGTGTCTAGATTT[T/C]
GGGATATCATTATTTGGGGTTATATATTGAGGATGAGAGGTGGGCCGCTGATGGTGACAGCTCAATACGGGTATTCCTCCGTGCCGGTATATAATCCTAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.00% 29.30% 0.28% 35.48% NA
All Indica  2759 39.30% 24.90% 0.47% 35.30% NA
All Japonica  1512 25.30% 44.10% 0.00% 30.56% NA
Aus  269 42.80% 1.10% 0.00% 56.13% NA
Indica I  595 46.60% 44.50% 0.17% 8.74% NA
Indica II  465 19.10% 20.60% 1.51% 58.71% NA
Indica III  913 40.90% 16.30% 0.11% 42.72% NA
Indica Intermediate  786 44.00% 22.50% 0.51% 32.95% NA
Temperate Japonica  767 21.50% 74.30% 0.00% 4.17% NA
Tropical Japonica  504 34.70% 4.60% 0.00% 60.71% NA
Japonica Intermediate  241 17.80% 30.70% 0.00% 51.45% NA
VI/Aromatic  96 34.40% 1.00% 0.00% 64.58% NA
Intermediate  90 40.00% 28.90% 0.00% 31.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217803999 A -> DEL N N silent_mutation Average:26.934; most accessible tissue: Zhenshan97 flag leaf, score: 64.768 N N N N
vg1217803999 A -> G LOC_Os12g29780.1 downstream_gene_variant ; 631.0bp to feature; MODIFIER silent_mutation Average:26.934; most accessible tissue: Zhenshan97 flag leaf, score: 64.768 N N N N
vg1217803999 A -> G LOC_Os12g29790.1 downstream_gene_variant ; 1522.0bp to feature; MODIFIER silent_mutation Average:26.934; most accessible tissue: Zhenshan97 flag leaf, score: 64.768 N N N N
vg1217803999 A -> G LOC_Os12g29780-LOC_Os12g29790 intergenic_region ; MODIFIER silent_mutation Average:26.934; most accessible tissue: Zhenshan97 flag leaf, score: 64.768 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217803999 NA 5.05E-18 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1217803999 7.50E-06 NA mr1454 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217803999 NA 1.64E-07 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217803999 NA 1.46E-06 mr1045_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217803999 NA 7.94E-06 mr1053_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217803999 NA 7.05E-06 mr1058_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217803999 NA 8.03E-07 mr1207_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217803999 NA 1.05E-06 mr1208_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217803999 NA 6.29E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217803999 NA 3.85E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217803999 5.80E-06 5.80E-06 mr1259_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217803999 NA 4.86E-07 mr1302_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217803999 NA 8.81E-07 mr1306_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217803999 NA 4.72E-06 mr1421_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217803999 3.23E-06 3.23E-06 mr1424_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217803999 4.64E-06 4.64E-06 mr1529_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217803999 NA 6.98E-06 mr1562_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217803999 NA 5.24E-06 mr1605_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217803999 NA 3.04E-06 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217803999 NA 1.15E-07 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217803999 NA 3.89E-06 mr1752_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217803999 NA 2.99E-06 mr1771_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217803999 NA 4.30E-06 mr1787_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217803999 NA 1.87E-06 mr1813_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217803999 NA 8.91E-07 mr1824_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217803999 NA 5.56E-07 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217803999 NA 2.53E-06 mr1844_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217803999 NA 3.44E-07 mr1854_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217803999 NA 5.07E-06 mr1876_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217803999 NA 6.80E-06 mr1960_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251