\
| Variant ID: vg1217803999 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 17803999 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 99. )
TTAGGATTATATACCGGCACGGAGGAATACCCGTATTGAGCTGTCACCATCAGCGGCCCACCTCTCATCCTCAATATATAACCCCAAATAATGATATCCC[A/G]
AAATCTAGACACCACGTCTAAACTACCAGATACTACTCTAATATCTTCGTCATGACATAGAGTAATTGCATAAGCAAACATTATACCCGCACCAAAGCAT
ATGCTTTGGTGCGGGTATAATGTTTGCTTATGCAATTACTCTATGTCATGACGAAGATATTAGAGTAGTATCTGGTAGTTTAGACGTGGTGTCTAGATTT[T/C]
GGGATATCATTATTTGGGGTTATATATTGAGGATGAGAGGTGGGCCGCTGATGGTGACAGCTCAATACGGGTATTCCTCCGTGCCGGTATATAATCCTAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.00% | 29.30% | 0.28% | 35.48% | NA |
| All Indica | 2759 | 39.30% | 24.90% | 0.47% | 35.30% | NA |
| All Japonica | 1512 | 25.30% | 44.10% | 0.00% | 30.56% | NA |
| Aus | 269 | 42.80% | 1.10% | 0.00% | 56.13% | NA |
| Indica I | 595 | 46.60% | 44.50% | 0.17% | 8.74% | NA |
| Indica II | 465 | 19.10% | 20.60% | 1.51% | 58.71% | NA |
| Indica III | 913 | 40.90% | 16.30% | 0.11% | 42.72% | NA |
| Indica Intermediate | 786 | 44.00% | 22.50% | 0.51% | 32.95% | NA |
| Temperate Japonica | 767 | 21.50% | 74.30% | 0.00% | 4.17% | NA |
| Tropical Japonica | 504 | 34.70% | 4.60% | 0.00% | 60.71% | NA |
| Japonica Intermediate | 241 | 17.80% | 30.70% | 0.00% | 51.45% | NA |
| VI/Aromatic | 96 | 34.40% | 1.00% | 0.00% | 64.58% | NA |
| Intermediate | 90 | 40.00% | 28.90% | 0.00% | 31.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1217803999 | A -> DEL | N | N | silent_mutation | Average:26.934; most accessible tissue: Zhenshan97 flag leaf, score: 64.768 | N | N | N | N |
| vg1217803999 | A -> G | LOC_Os12g29780.1 | downstream_gene_variant ; 631.0bp to feature; MODIFIER | silent_mutation | Average:26.934; most accessible tissue: Zhenshan97 flag leaf, score: 64.768 | N | N | N | N |
| vg1217803999 | A -> G | LOC_Os12g29790.1 | downstream_gene_variant ; 1522.0bp to feature; MODIFIER | silent_mutation | Average:26.934; most accessible tissue: Zhenshan97 flag leaf, score: 64.768 | N | N | N | N |
| vg1217803999 | A -> G | LOC_Os12g29780-LOC_Os12g29790 | intergenic_region ; MODIFIER | silent_mutation | Average:26.934; most accessible tissue: Zhenshan97 flag leaf, score: 64.768 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1217803999 | NA | 5.05E-18 | Plant_height | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1217803999 | 7.50E-06 | NA | mr1454 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217803999 | NA | 1.64E-07 | mr1627 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217803999 | NA | 1.46E-06 | mr1045_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217803999 | NA | 7.94E-06 | mr1053_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217803999 | NA | 7.05E-06 | mr1058_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217803999 | NA | 8.03E-07 | mr1207_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217803999 | NA | 1.05E-06 | mr1208_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217803999 | NA | 6.29E-06 | mr1215_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217803999 | NA | 3.85E-06 | mr1220_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217803999 | 5.80E-06 | 5.80E-06 | mr1259_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217803999 | NA | 4.86E-07 | mr1302_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217803999 | NA | 8.81E-07 | mr1306_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217803999 | NA | 4.72E-06 | mr1421_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217803999 | 3.23E-06 | 3.23E-06 | mr1424_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217803999 | 4.64E-06 | 4.64E-06 | mr1529_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217803999 | NA | 6.98E-06 | mr1562_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217803999 | NA | 5.24E-06 | mr1605_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217803999 | NA | 3.04E-06 | mr1611_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217803999 | NA | 1.15E-07 | mr1653_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217803999 | NA | 3.89E-06 | mr1752_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217803999 | NA | 2.99E-06 | mr1771_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217803999 | NA | 4.30E-06 | mr1787_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217803999 | NA | 1.87E-06 | mr1813_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217803999 | NA | 8.91E-07 | mr1824_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217803999 | NA | 5.56E-07 | mr1838_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217803999 | NA | 2.53E-06 | mr1844_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217803999 | NA | 3.44E-07 | mr1854_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217803999 | NA | 5.07E-06 | mr1876_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217803999 | NA | 6.80E-06 | mr1960_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |