Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1217798352:

Variant ID: vg1217798352 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 17798352
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:

CCCTACCCCTATGATCACATTCGAAGAGTAGGCCGGCAAATCCTTGAAATTGACGAAGTCACCATAGGCACCTCGTTGTTGCCTACCACTGAAAGCACAC[C/A]
GCCATTAAATCCTGGAAAATTTGCTCCTATCACTGAAAGCACAACGTTATTAAATCCTGAAAAATTCGCTCTCATGGAGAGTCGAACCCAGGACCTTAGG

Reverse complement sequence

CCTAAGGTCCTGGGTTCGACTCTCCATGAGAGCGAATTTTTCAGGATTTAATAACGTTGTGCTTTCAGTGATAGGAGCAAATTTTCCAGGATTTAATGGC[G/T]
GTGTGCTTTCAGTGGTAGGCAACAACGAGGTGCCTATGGTGACTTCGTCAATTTCAAGGATTTGCCGGCCTACTCTTCGAATGTGATCATAGGGGTAGGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.60%	12.50%	0.55%	32.33%	NA
All Indica	2759	46.40%	20.60%	0.47%	32.48%	NA
All Japonica	1512	69.40%	0.40%	0.46%	29.70%	NA
Aus	269	61.30%	0.70%	0.74%	37.17%	NA
Indica I	595	62.40%	35.50%	0.17%	2.02%	NA
Indica II	465	26.70%	14.40%	0.86%	58.06%	NA
Indica III	913	45.90%	11.70%	0.55%	41.84%	NA
Indica Intermediate	786	46.70%	23.40%	0.38%	29.52%	NA
Temperate Japonica	767	95.70%	0.50%	0.13%	3.65%	NA
Tropical Japonica	504	40.30%	0.20%	0.79%	58.73%	NA
Japonica Intermediate	241	46.90%	0.40%	0.83%	51.87%	NA
VI/Aromatic	96	36.50%	1.00%	3.12%	59.38%	NA
Intermediate	90	56.70%	13.30%	1.11%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1217798352	C -> DEL	N	N	silent_mutation	Average:29.632; most accessible tissue: Zhenshan97 flag leaf, score: 64.768	N	N	N	N
vg1217798352	C -> A	LOC_Os12g29780.1	upstream_gene_variant ; 3764.0bp to feature; MODIFIER	silent_mutation	Average:29.632; most accessible tissue: Zhenshan97 flag leaf, score: 64.768	N	N	N	N
vg1217798352	C -> A	LOC_Os12g29760-LOC_Os12g29780	intergenic_region ; MODIFIER	silent_mutation	Average:29.632; most accessible tissue: Zhenshan97 flag leaf, score: 64.768	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1217798352	NA	1.61E-06	mr1180	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217798352	NA	4.47E-07	mr1336	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217798352	NA	1.75E-07	mr1579	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217798352	3.39E-06	NA	mr1458_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251