Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1217654469:

Variant ID: vg1217654469 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 17654469
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.77, T: 0.24, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:

GGTATTATCATATTTTACACATGAAAATATGTCTTATTCTCAACACTAACATGAGCTGGGAGTTGGAAAAGATGAATGGATGCGCAGAACTCATCGCGCA[G/T]
GGAAAATATGAATGGATGCAGCCATGTGTATCAACATGAAAGAAAATGTTTGTACGTGATTGAATTGAATCAAAACCGTGGGACGTCACGCGCGCACAGA

Reverse complement sequence

TCTGTGCGCGCGTGACGTCCCACGGTTTTGATTCAATTCAATCACGTACAAACATTTTCTTTCATGTTGATACACATGGCTGCATCCATTCATATTTTCC[C/A]
TGCGCGATGAGTTCTGCGCATCCATTCATCTTTTCCAACTCCCAGCTCATGTTAGTGTTGAGAATAAGACATATTTTCATGTGTAAAATATGATAATACC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.00%	21.90%	0.15%	0.00%	NA
All Indica	2759	87.80%	12.00%	0.18%	0.00%	NA
All Japonica	1512	70.90%	29.00%	0.07%	0.00%	NA
Aus	269	46.10%	53.90%	0.00%	0.00%	NA
Indica I	595	83.20%	16.80%	0.00%	0.00%	NA
Indica II	465	98.70%	1.10%	0.22%	0.00%	NA
Indica III	913	88.20%	11.60%	0.22%	0.00%	NA
Indica Intermediate	786	84.40%	15.40%	0.25%	0.00%	NA
Temperate Japonica	767	77.70%	22.30%	0.00%	0.00%	NA
Tropical Japonica	504	59.70%	40.10%	0.20%	0.00%	NA
Japonica Intermediate	241	72.60%	27.40%	0.00%	0.00%	NA
VI/Aromatic	96	12.50%	87.50%	0.00%	0.00%	NA
Intermediate	90	60.00%	38.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1217654469	G -> T	LOC_Os12g29590.1	upstream_gene_variant ; 1160.0bp to feature; MODIFIER	silent_mutation	Average:59.968; most accessible tissue: Callus, score: 86.114	N	N	N	N
vg1217654469	G -> T	LOC_Os12g29600.1	upstream_gene_variant ; 4126.0bp to feature; MODIFIER	silent_mutation	Average:59.968; most accessible tissue: Callus, score: 86.114	N	N	N	N
vg1217654469	G -> T	LOC_Os12g29580-LOC_Os12g29590	intergenic_region ; MODIFIER	silent_mutation	Average:59.968; most accessible tissue: Callus, score: 86.114	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1217654469	NA	5.37E-07	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217654469	NA	1.29E-06	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217654469	NA	3.65E-07	mr1458	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217654469	NA	4.63E-06	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217654469	NA	2.26E-07	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217654469	8.26E-06	NA	mr1715	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217654469	NA	2.44E-06	mr1786	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217654469	NA	4.50E-06	mr1794	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217654469	NA	1.62E-08	mr1458_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251