\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217654469:

Variant ID: vg1217654469 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17654469
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.77, T: 0.24, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


GGTATTATCATATTTTACACATGAAAATATGTCTTATTCTCAACACTAACATGAGCTGGGAGTTGGAAAAGATGAATGGATGCGCAGAACTCATCGCGCA[G/T]
GGAAAATATGAATGGATGCAGCCATGTGTATCAACATGAAAGAAAATGTTTGTACGTGATTGAATTGAATCAAAACCGTGGGACGTCACGCGCGCACAGA

Reverse complement sequence

TCTGTGCGCGCGTGACGTCCCACGGTTTTGATTCAATTCAATCACGTACAAACATTTTCTTTCATGTTGATACACATGGCTGCATCCATTCATATTTTCC[C/A]
TGCGCGATGAGTTCTGCGCATCCATTCATCTTTTCCAACTCCCAGCTCATGTTAGTGTTGAGAATAAGACATATTTTCATGTGTAAAATATGATAATACC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.00% 21.90% 0.15% 0.00% NA
All Indica  2759 87.80% 12.00% 0.18% 0.00% NA
All Japonica  1512 70.90% 29.00% 0.07% 0.00% NA
Aus  269 46.10% 53.90% 0.00% 0.00% NA
Indica I  595 83.20% 16.80% 0.00% 0.00% NA
Indica II  465 98.70% 1.10% 0.22% 0.00% NA
Indica III  913 88.20% 11.60% 0.22% 0.00% NA
Indica Intermediate  786 84.40% 15.40% 0.25% 0.00% NA
Temperate Japonica  767 77.70% 22.30% 0.00% 0.00% NA
Tropical Japonica  504 59.70% 40.10% 0.20% 0.00% NA
Japonica Intermediate  241 72.60% 27.40% 0.00% 0.00% NA
VI/Aromatic  96 12.50% 87.50% 0.00% 0.00% NA
Intermediate  90 60.00% 38.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217654469 G -> T LOC_Os12g29590.1 upstream_gene_variant ; 1160.0bp to feature; MODIFIER silent_mutation Average:59.968; most accessible tissue: Callus, score: 86.114 N N N N
vg1217654469 G -> T LOC_Os12g29600.1 upstream_gene_variant ; 4126.0bp to feature; MODIFIER silent_mutation Average:59.968; most accessible tissue: Callus, score: 86.114 N N N N
vg1217654469 G -> T LOC_Os12g29580-LOC_Os12g29590 intergenic_region ; MODIFIER silent_mutation Average:59.968; most accessible tissue: Callus, score: 86.114 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217654469 NA 5.37E-07 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217654469 NA 1.29E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217654469 NA 3.65E-07 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217654469 NA 4.63E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217654469 NA 2.26E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217654469 8.26E-06 NA mr1715 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217654469 NA 2.44E-06 mr1786 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217654469 NA 4.50E-06 mr1794 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217654469 NA 1.62E-08 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251