\
| Variant ID: vg1217654469 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 17654469 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.77, T: 0.24, others allele: 0.00, population size: 195. )
GGTATTATCATATTTTACACATGAAAATATGTCTTATTCTCAACACTAACATGAGCTGGGAGTTGGAAAAGATGAATGGATGCGCAGAACTCATCGCGCA[G/T]
GGAAAATATGAATGGATGCAGCCATGTGTATCAACATGAAAGAAAATGTTTGTACGTGATTGAATTGAATCAAAACCGTGGGACGTCACGCGCGCACAGA
TCTGTGCGCGCGTGACGTCCCACGGTTTTGATTCAATTCAATCACGTACAAACATTTTCTTTCATGTTGATACACATGGCTGCATCCATTCATATTTTCC[C/A]
TGCGCGATGAGTTCTGCGCATCCATTCATCTTTTCCAACTCCCAGCTCATGTTAGTGTTGAGAATAAGACATATTTTCATGTGTAAAATATGATAATACC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.00% | 21.90% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 87.80% | 12.00% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 70.90% | 29.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 46.10% | 53.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 83.20% | 16.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.10% | 0.22% | 0.00% | NA |
| Indica III | 913 | 88.20% | 11.60% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 84.40% | 15.40% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 77.70% | 22.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 59.70% | 40.10% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 72.60% | 27.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 12.50% | 87.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 60.00% | 38.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1217654469 | G -> T | LOC_Os12g29590.1 | upstream_gene_variant ; 1160.0bp to feature; MODIFIER | silent_mutation | Average:59.968; most accessible tissue: Callus, score: 86.114 | N | N | N | N |
| vg1217654469 | G -> T | LOC_Os12g29600.1 | upstream_gene_variant ; 4126.0bp to feature; MODIFIER | silent_mutation | Average:59.968; most accessible tissue: Callus, score: 86.114 | N | N | N | N |
| vg1217654469 | G -> T | LOC_Os12g29580-LOC_Os12g29590 | intergenic_region ; MODIFIER | silent_mutation | Average:59.968; most accessible tissue: Callus, score: 86.114 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1217654469 | NA | 5.37E-07 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217654469 | NA | 1.29E-06 | mr1183 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217654469 | NA | 3.65E-07 | mr1458 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217654469 | NA | 4.63E-06 | mr1503 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217654469 | NA | 2.26E-07 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217654469 | 8.26E-06 | NA | mr1715 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217654469 | NA | 2.44E-06 | mr1786 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217654469 | NA | 4.50E-06 | mr1794 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217654469 | NA | 1.62E-08 | mr1458_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |