\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217652673:

Variant ID: vg1217652673 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17652673
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCCTTTTTTATTTTCTTTTTCTCTTTTCTTTTCTCCCAATCATTATGATCCTCTCCAGCCAATCTCCTATCTTTTTTCCTCCGTTTCTCTTTTTTTCTC[T/C]
ATTTTTTCTCTTCCAAGTTTCTCTCCTCGTAAATATTTTTCTTTTGGAACTATGATTGTTTAAGGTGTGTATGCAACAAGTTTGTTGCTTTGCAAATGTT

Reverse complement sequence

AACATTTGCAAAGCAACAAACTTGTTGCATACACACCTTAAACAATCATAGTTCCAAAAGAAAAATATTTACGAGGAGAGAAACTTGGAAGAGAAAAAAT[A/G]
GAGAAAAAAAGAGAAACGGAGGAAAAAAGATAGGAGATTGGCTGGAGAGGATCATAATGATTGGGAGAAAAGAAAAGAGAAAAAGAAAATAAAAAAGGGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.90% 27.00% 0.51% 5.65% NA
All Indica  2759 87.50% 12.30% 0.00% 0.14% NA
All Japonica  1512 33.00% 48.50% 1.52% 17.00% NA
Aus  269 61.00% 39.00% 0.00% 0.00% NA
Indica I  595 92.80% 7.20% 0.00% 0.00% NA
Indica II  465 93.80% 6.00% 0.00% 0.22% NA
Indica III  913 81.80% 18.10% 0.00% 0.11% NA
Indica Intermediate  786 86.50% 13.20% 0.00% 0.25% NA
Temperate Japonica  767 21.50% 76.50% 0.26% 1.69% NA
Tropical Japonica  504 55.60% 9.70% 1.19% 33.53% NA
Japonica Intermediate  241 22.40% 40.20% 6.22% 31.12% NA
VI/Aromatic  96 44.80% 55.20% 0.00% 0.00% NA
Intermediate  90 44.40% 47.80% 1.11% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217652673 T -> C LOC_Os12g29590.1 upstream_gene_variant ; 2956.0bp to feature; MODIFIER silent_mutation Average:73.033; most accessible tissue: Zhenshan97 flower, score: 81.593 N N N N
vg1217652673 T -> C LOC_Os12g29580-LOC_Os12g29590 intergenic_region ; MODIFIER silent_mutation Average:73.033; most accessible tissue: Zhenshan97 flower, score: 81.593 N N N N
vg1217652673 T -> DEL N N silent_mutation Average:73.033; most accessible tissue: Zhenshan97 flower, score: 81.593 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217652673 NA 5.83E-07 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217652673 NA 2.91E-07 mr1334 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217652673 3.16E-06 NA mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217652673 1.18E-06 6.70E-07 mr1489 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217652673 NA 4.77E-06 mr1719 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217652673 NA 1.66E-06 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217652673 NA 1.90E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217652673 8.46E-08 NA mr1023_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217652673 4.11E-07 NA mr1079_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217652673 NA 4.87E-06 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217652673 NA 7.66E-06 mr1193_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217652673 5.93E-09 NA mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217652673 NA 1.50E-08 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217652673 2.08E-08 NA mr1778_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217652673 NA 2.16E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251