Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217652673:

Variant ID: vg1217652673 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 17652673
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCCCTTTTTTATTTTCTTTTTCTCTTTTCTTTTCTCCCAATCATTATGATCCTCTCCAGCCAATCTCCTATCTTTTTTCCTCCGTTTCTCTTTTTTTCTC[T/C]
ATTTTTTCTCTTCCAAGTTTCTCTCCTCGTAAATATTTTTCTTTTGGAACTATGATTGTTTAAGGTGTGTATGCAACAAGTTTGTTGCTTTGCAAATGTT

Reverse complement sequence

AACATTTGCAAAGCAACAAACTTGTTGCATACACACCTTAAACAATCATAGTTCCAAAAGAAAAATATTTACGAGGAGAGAAACTTGGAAGAGAAAAAAT[A/G]
GAGAAAAAAAGAGAAACGGAGGAAAAAAGATAGGAGATTGGCTGGAGAGGATCATAATGATTGGGAGAAAAGAAAAGAGAAAAAGAAAATAAAAAAGGGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.90%	27.00%	0.51%	5.65%	NA
All Indica	2759	87.50%	12.30%	0.00%	0.14%	NA
All Japonica	1512	33.00%	48.50%	1.52%	17.00%	NA
Aus	269	61.00%	39.00%	0.00%	0.00%	NA
Indica I	595	92.80%	7.20%	0.00%	0.00%	NA
Indica II	465	93.80%	6.00%	0.00%	0.22%	NA
Indica III	913	81.80%	18.10%	0.00%	0.11%	NA
Indica Intermediate	786	86.50%	13.20%	0.00%	0.25%	NA
Temperate Japonica	767	21.50%	76.50%	0.26%	1.69%	NA
Tropical Japonica	504	55.60%	9.70%	1.19%	33.53%	NA
Japonica Intermediate	241	22.40%	40.20%	6.22%	31.12%	NA
VI/Aromatic	96	44.80%	55.20%	0.00%	0.00%	NA
Intermediate	90	44.40%	47.80%	1.11%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1217652673	T -> C	LOC_Os12g29590.1	upstream_gene_variant ; 2956.0bp to feature; MODIFIER	silent_mutation	Average:73.033; most accessible tissue: Zhenshan97 flower, score: 81.593	N	N	N	N
vg1217652673	T -> C	LOC_Os12g29580-LOC_Os12g29590	intergenic_region ; MODIFIER	silent_mutation	Average:73.033; most accessible tissue: Zhenshan97 flower, score: 81.593	N	N	N	N
vg1217652673	T -> DEL	N	N	silent_mutation	Average:73.033; most accessible tissue: Zhenshan97 flower, score: 81.593	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1217652673	NA	5.83E-07	mr1002	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217652673	NA	2.91E-07	mr1334	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217652673	3.16E-06	NA	mr1489	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217652673	1.18E-06	6.70E-07	mr1489	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217652673	NA	4.77E-06	mr1719	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217652673	NA	1.66E-06	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217652673	NA	1.90E-07	mr1805	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217652673	8.46E-08	NA	mr1023_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217652673	4.11E-07	NA	mr1079_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217652673	NA	4.87E-06	mr1182_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217652673	NA	7.66E-06	mr1193_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217652673	5.93E-09	NA	mr1489_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217652673	NA	1.50E-08	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217652673	2.08E-08	NA	mr1778_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217652673	NA	2.16E-08	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251