\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217642122:

Variant ID: vg1217642122 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 17642122
Reference Allele: AAGCTACATTTACAGTTAACTGGAlternative Allele: TAGCTACATTTACAGTTAACTGG,A
Primary Allele: AAGCTACATTTACAGTTAAC TGGSecondary Allele: TAGCTACATTTACAGTTAAC TGG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATCAACTATAAATTTAAGATTTAAAATTAAATTTTAATTATGGCCAATAAGTTGAAAAGCAAACGATGCAGCTTATTGTTTGGTCATGCTGTGAGTCCA[AAGCTACATTTACAGTTAACTGG/TAGCTACATTTACAGTTAACTGG,A]
GATTTGCCAATTAATTTTAACTCCTCGGTTAAGATGTATATGCCCAATATCTTTTAGCATGCATGAGTATGTTTAGTGGTGGGATCGTGGTAGTATATGC

Reverse complement sequence

GCATATACTACCACGATCCCACCACTAAACATACTCATGCATGCTAAAAGATATTGGGCATATACATCTTAACCGAGGAGTTAAAATTAATTGGCAAATC[CCAGTTAACTGTAAATGTAGCTT/CCAGTTAACTGTAAATGTAGCTA,T]
TGGACTCACAGCATGACCAAACAATAAGCTGCATCGTTTGCTTTTCAACTTATTGGCCATAATTAAAATTTAATTTTAAATCTTAAATTTATAGTTGATT

Allele Frequencies:

Populations Population SizeFrequency of AAGCTACATTTACAGTTAAC TGG(primary allele) Frequency of TAGCTACATTTACAGTTAAC TGG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.00% 12.00% 0.04% 0.00% NA
All Indica  2759 92.50% 7.50% 0.04% 0.00% NA
All Japonica  1512 81.20% 18.70% 0.07% 0.00% NA
Aus  269 91.40% 8.60% 0.00% 0.00% NA
Indica I  595 98.20% 1.70% 0.17% 0.00% NA
Indica II  465 92.30% 7.70% 0.00% 0.00% NA
Indica III  913 88.70% 11.30% 0.00% 0.00% NA
Indica Intermediate  786 92.70% 7.30% 0.00% 0.00% NA
Temperate Japonica  767 94.00% 6.00% 0.00% 0.00% NA
Tropical Japonica  504 63.30% 36.70% 0.00% 0.00% NA
Japonica Intermediate  241 78.00% 21.60% 0.41% 0.00% NA
VI/Aromatic  96 62.50% 37.50% 0.00% 0.00% NA
Intermediate  90 80.00% 20.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217642122 AAGCTACATTTACAGTTAACTGG -> A LOC_Os12g29580-LOC_Os12g29590 intergenic_region ; MODIFIER N Average:58.326; most accessible tissue: Zhenshan97 root, score: 76.035 N N N N
vg1217642122 AAGCTACATTTACAGTTAACTGG -> TAGCTACATTTACAGTTAACTGG LOC_Os12g29580-LOC_Os12g29590 intergenic_region ; MODIFIER silent_mutation Average:58.326; most accessible tissue: Zhenshan97 root, score: 76.035 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217642122 NA 3.39E-06 mr1171 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217642122 NA 1.88E-06 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217642122 NA 3.53E-07 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217642122 NA 4.39E-06 mr1324 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217642122 NA 4.17E-06 mr1335 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217642122 NA 1.63E-06 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217642122 6.90E-07 6.35E-10 mr1565 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217642122 NA 1.05E-06 mr1786 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251