Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217621842:

Variant ID: vg1217621842 (JBrowse)	Variation Type: INDEL
Chromosome: chr12	Position: 17621842
Reference Allele: TA	Alternative Allele: TAA,AA,TTAA,TTTAA,T,TAAAAAA
Primary Allele: TA	Secondary Allele: AA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACCTCGGTTGTTTACTATGCACACTGCACACTGCAGAAATACTGTTATGCGCAGCAGTTCTATTTGTTCCCAACCATGTGGCTCAAAGTGTTTTTTTTTT[TA/TAA,AA,TTAA,TTTAA,T,TAAAAAA]
AAAAAATCTTCTTTTATTCTTGTTAAGGATTTGGAAAGTTCTATTGCATATCTGCAGTCTGCACTATGATAAGAGTTTCTGGTGAATGTACAGTTATAGG

Reverse complement sequence

CCTATAACTGTACATTCACCAGAAACTCTTATCATAGTGCAGACTGCAGATATGCAATAGAACTTTCCAAATCCTTAACAAGAATAAAAGAAGATTTTTT[TA/TTA,TT,TTAA,TTAAA,A,TTTTTTA]
AAAAAAAAAACACTTTGAGCCACATGGTTGGGAACAAATAGAACTGCTGCGCATAACAGTATTTCTGCAGTGTGCAGTGTGCATAGTAAACAACCGAGGT

Allele Frequencies:

Populations	Population Size	Frequency of TA(primary allele)	Frequency of AA(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.10%	29.40%	1.29%	0.00%	TTAA: 4.72%; TAA: 3.20%; T: 0.21%; TAAAAAA: 0.04%; TTTAA: 0.04%
All Indica	2759	60.90%	34.10%	0.51%	0.00%	TTAA: 2.25%; TAA: 2.17%; TAAAAAA: 0.04%; T: 0.04%
All Japonica	1512	68.50%	21.10%	2.31%	0.00%	TTAA: 5.69%; TAA: 2.38%
Aus	269	24.50%	37.50%	2.97%	0.00%	TAA: 17.47%; TTAA: 16.73%; TTTAA: 0.74%
Indica I	595	52.80%	45.50%	1.51%	0.00%	TTAA: 0.17%
Indica II	465	72.90%	14.80%	0.43%	0.00%	TTAA: 9.25%; TAA: 2.58%
Indica III	913	67.00%	29.80%	0.00%	0.00%	TAA: 2.85%; TTAA: 0.22%; T: 0.11%
Indica Intermediate	786	52.90%	41.70%	0.38%	0.00%	TAA: 2.80%; TTAA: 2.04%; TAAAAAA: 0.13%
Temperate Japonica	767	92.30%	5.00%	2.35%	0.00%	TTAA: 0.26%; TAA: 0.13%
Tropical Japonica	504	40.30%	35.50%	2.98%	0.00%	TTAA: 14.68%; TAA: 6.55%
Japonica Intermediate	241	51.90%	42.30%	0.83%	0.00%	TTAA: 4.15%; TAA: 0.83%
VI/Aromatic	96	58.30%	4.20%	1.04%	0.00%	TTAA: 22.92%; TAA: 7.29%; T: 6.25%
Intermediate	90	54.40%	27.80%	3.33%	0.00%	TTAA: 8.89%; T: 3.33%; TAAAAAA: 1.11%; TAA: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1217621842	TA -> TAA	LOC_Os12g29570.1	upstream_gene_variant ; 2615.0bp to feature; MODIFIER	silent_mutation	Average:61.476; most accessible tissue: Minghui63 flag leaf, score: 76.807	N	N	N	N
vg1217621842	TA -> TAA	LOC_Os12g29570.2	upstream_gene_variant ; 2615.0bp to feature; MODIFIER	silent_mutation	Average:61.476; most accessible tissue: Minghui63 flag leaf, score: 76.807	N	N	N	N
vg1217621842	TA -> TAA	LOC_Os12g29550.1	downstream_gene_variant ; 3254.0bp to feature; MODIFIER	silent_mutation	Average:61.476; most accessible tissue: Minghui63 flag leaf, score: 76.807	N	N	N	N
vg1217621842	TA -> TAA	LOC_Os12g29560.1	intron_variant ; MODIFIER	silent_mutation	Average:61.476; most accessible tissue: Minghui63 flag leaf, score: 76.807	N	N	N	N
vg1217621842	TA -> TTTAA	LOC_Os12g29570.1	upstream_gene_variant ; 2616.0bp to feature; MODIFIER	silent_mutation	Average:61.476; most accessible tissue: Minghui63 flag leaf, score: 76.807	N	N	N	N
vg1217621842	TA -> TTTAA	LOC_Os12g29570.2	upstream_gene_variant ; 2616.0bp to feature; MODIFIER	silent_mutation	Average:61.476; most accessible tissue: Minghui63 flag leaf, score: 76.807	N	N	N	N
vg1217621842	TA -> TTTAA	LOC_Os12g29550.1	downstream_gene_variant ; 3253.0bp to feature; MODIFIER	silent_mutation	Average:61.476; most accessible tissue: Minghui63 flag leaf, score: 76.807	N	N	N	N
vg1217621842	TA -> TTTAA	LOC_Os12g29560.1	intron_variant ; MODIFIER	silent_mutation	Average:61.476; most accessible tissue: Minghui63 flag leaf, score: 76.807	N	N	N	N
vg1217621842	TA -> TAAAAAA	LOC_Os12g29570.1	upstream_gene_variant ; 2615.0bp to feature; MODIFIER	silent_mutation	Average:61.476; most accessible tissue: Minghui63 flag leaf, score: 76.807	N	N	N	N
vg1217621842	TA -> TAAAAAA	LOC_Os12g29570.2	upstream_gene_variant ; 2615.0bp to feature; MODIFIER	silent_mutation	Average:61.476; most accessible tissue: Minghui63 flag leaf, score: 76.807	N	N	N	N
vg1217621842	TA -> TAAAAAA	LOC_Os12g29550.1	downstream_gene_variant ; 3254.0bp to feature; MODIFIER	silent_mutation	Average:61.476; most accessible tissue: Minghui63 flag leaf, score: 76.807	N	N	N	N
vg1217621842	TA -> TAAAAAA	LOC_Os12g29560.1	intron_variant ; MODIFIER	silent_mutation	Average:61.476; most accessible tissue: Minghui63 flag leaf, score: 76.807	N	N	N	N
vg1217621842	TA -> T	LOC_Os12g29570.1	upstream_gene_variant ; 2616.0bp to feature; MODIFIER	silent_mutation	Average:61.476; most accessible tissue: Minghui63 flag leaf, score: 76.807	N	N	N	N
vg1217621842	TA -> T	LOC_Os12g29570.2	upstream_gene_variant ; 2616.0bp to feature; MODIFIER	silent_mutation	Average:61.476; most accessible tissue: Minghui63 flag leaf, score: 76.807	N	N	N	N
vg1217621842	TA -> T	LOC_Os12g29550.1	downstream_gene_variant ; 3253.0bp to feature; MODIFIER	silent_mutation	Average:61.476; most accessible tissue: Minghui63 flag leaf, score: 76.807	N	N	N	N
vg1217621842	TA -> T	LOC_Os12g29560.1	intron_variant ; MODIFIER	silent_mutation	Average:61.476; most accessible tissue: Minghui63 flag leaf, score: 76.807	N	N	N	N
vg1217621842	TA -> TTAA	LOC_Os12g29570.1	upstream_gene_variant ; 2616.0bp to feature; MODIFIER	silent_mutation	Average:61.476; most accessible tissue: Minghui63 flag leaf, score: 76.807	N	N	N	N
vg1217621842	TA -> TTAA	LOC_Os12g29570.2	upstream_gene_variant ; 2616.0bp to feature; MODIFIER	silent_mutation	Average:61.476; most accessible tissue: Minghui63 flag leaf, score: 76.807	N	N	N	N
vg1217621842	TA -> TTAA	LOC_Os12g29550.1	downstream_gene_variant ; 3253.0bp to feature; MODIFIER	silent_mutation	Average:61.476; most accessible tissue: Minghui63 flag leaf, score: 76.807	N	N	N	N
vg1217621842	TA -> TTAA	LOC_Os12g29560.1	intron_variant ; MODIFIER	silent_mutation	Average:61.476; most accessible tissue: Minghui63 flag leaf, score: 76.807	N	N	N	N
vg1217621842	TA -> AA	LOC_Os12g29570.1	upstream_gene_variant ; 2617.0bp to feature; MODIFIER	silent_mutation	Average:61.476; most accessible tissue: Minghui63 flag leaf, score: 76.807	N	N	N	N
vg1217621842	TA -> AA	LOC_Os12g29570.2	upstream_gene_variant ; 2617.0bp to feature; MODIFIER	silent_mutation	Average:61.476; most accessible tissue: Minghui63 flag leaf, score: 76.807	N	N	N	N
vg1217621842	TA -> AA	LOC_Os12g29550.1	downstream_gene_variant ; 3252.0bp to feature; MODIFIER	silent_mutation	Average:61.476; most accessible tissue: Minghui63 flag leaf, score: 76.807	N	N	N	N
vg1217621842	TA -> AA	LOC_Os12g29560.1	intron_variant ; MODIFIER	silent_mutation	Average:61.476; most accessible tissue: Minghui63 flag leaf, score: 76.807	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1217621842	NA	1.77E-16	Plant_height	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1217621842	NA	4.55E-06	mr1002	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842	NA	1.81E-06	mr1020	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842	NA	9.52E-06	mr1021	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842	NA	8.06E-08	mr1032	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842	NA	9.04E-06	mr1057	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842	NA	9.12E-06	mr1063	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842	NA	3.54E-07	mr1113	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842	NA	5.73E-09	mr1114	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842	NA	8.58E-08	mr1116	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842	NA	3.76E-08	mr1117	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842	NA	7.61E-08	mr1119	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842	6.13E-07	1.74E-09	mr1120	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842	NA	5.32E-07	mr1165	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842	2.31E-06	2.31E-06	mr1200	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842	NA	4.44E-07	mr1240	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842	NA	9.33E-06	mr1242	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842	1.62E-06	1.07E-08	mr1247	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842	NA	6.80E-06	mr1477	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842	NA	3.51E-08	mr1478	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842	NA	2.28E-06	mr1496	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842	NA	7.41E-07	mr1583	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842	NA	8.83E-07	mr1627	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842	NA	4.44E-08	mr1660	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842	8.74E-06	2.45E-07	mr1917	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842	NA	8.80E-07	mr1950	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842	NA	5.70E-08	mr1971	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842	NA	6.14E-07	mr1063_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842	9.40E-07	1.99E-08	mr1113_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842	NA	4.12E-08	mr1114_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842	NA	1.41E-06	mr1115_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842	NA	5.45E-08	mr1117_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842	NA	7.12E-08	mr1119_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842	NA	6.02E-06	mr1120_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842	NA	2.70E-07	mr1159_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842	NA	2.13E-07	mr1165_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842	NA	2.55E-07	mr1183_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842	NA	4.18E-07	mr1240_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842	NA	9.14E-07	mr1247_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842	NA	2.06E-07	mr1378_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842	NA	4.80E-07	mr1478_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842	NA	9.17E-09	mr1653_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842	NA	7.93E-07	mr1759_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842	NA	6.11E-06	mr1823_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842	NA	3.25E-06	mr1856_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842	NA	1.69E-06	mr1861_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842	NA	9.58E-06	mr1971_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251