\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217621842:

Variant ID: vg1217621842 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 17621842
Reference Allele: TAAlternative Allele: TAA,AA,TTAA,TTTAA,T,TAAAAAA
Primary Allele: TASecondary Allele: AA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACCTCGGTTGTTTACTATGCACACTGCACACTGCAGAAATACTGTTATGCGCAGCAGTTCTATTTGTTCCCAACCATGTGGCTCAAAGTGTTTTTTTTTT[TA/TAA,AA,TTAA,TTTAA,T,TAAAAAA]
AAAAAATCTTCTTTTATTCTTGTTAAGGATTTGGAAAGTTCTATTGCATATCTGCAGTCTGCACTATGATAAGAGTTTCTGGTGAATGTACAGTTATAGG

Reverse complement sequence

CCTATAACTGTACATTCACCAGAAACTCTTATCATAGTGCAGACTGCAGATATGCAATAGAACTTTCCAAATCCTTAACAAGAATAAAAGAAGATTTTTT[TA/TTA,TT,TTAA,TTAAA,A,TTTTTTA]
AAAAAAAAAACACTTTGAGCCACATGGTTGGGAACAAATAGAACTGCTGCGCATAACAGTATTTCTGCAGTGTGCAGTGTGCATAGTAAACAACCGAGGT

Allele Frequencies:

Populations Population SizeFrequency of TA(primary allele) Frequency of AA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.10% 29.40% 1.29% 0.00% TTAA: 4.72%; TAA: 3.20%; T: 0.21%; TAAAAAA: 0.04%; TTTAA: 0.04%
All Indica  2759 60.90% 34.10% 0.51% 0.00% TTAA: 2.25%; TAA: 2.17%; TAAAAAA: 0.04%; T: 0.04%
All Japonica  1512 68.50% 21.10% 2.31% 0.00% TTAA: 5.69%; TAA: 2.38%
Aus  269 24.50% 37.50% 2.97% 0.00% TAA: 17.47%; TTAA: 16.73%; TTTAA: 0.74%
Indica I  595 52.80% 45.50% 1.51% 0.00% TTAA: 0.17%
Indica II  465 72.90% 14.80% 0.43% 0.00% TTAA: 9.25%; TAA: 2.58%
Indica III  913 67.00% 29.80% 0.00% 0.00% TAA: 2.85%; TTAA: 0.22%; T: 0.11%
Indica Intermediate  786 52.90% 41.70% 0.38% 0.00% TAA: 2.80%; TTAA: 2.04%; TAAAAAA: 0.13%
Temperate Japonica  767 92.30% 5.00% 2.35% 0.00% TTAA: 0.26%; TAA: 0.13%
Tropical Japonica  504 40.30% 35.50% 2.98% 0.00% TTAA: 14.68%; TAA: 6.55%
Japonica Intermediate  241 51.90% 42.30% 0.83% 0.00% TTAA: 4.15%; TAA: 0.83%
VI/Aromatic  96 58.30% 4.20% 1.04% 0.00% TTAA: 22.92%; TAA: 7.29%; T: 6.25%
Intermediate  90 54.40% 27.80% 3.33% 0.00% TTAA: 8.89%; T: 3.33%; TAAAAAA: 1.11%; TAA: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217621842 TA -> TAA LOC_Os12g29570.1 upstream_gene_variant ; 2615.0bp to feature; MODIFIER silent_mutation Average:61.476; most accessible tissue: Minghui63 flag leaf, score: 76.807 N N N N
vg1217621842 TA -> TAA LOC_Os12g29570.2 upstream_gene_variant ; 2615.0bp to feature; MODIFIER silent_mutation Average:61.476; most accessible tissue: Minghui63 flag leaf, score: 76.807 N N N N
vg1217621842 TA -> TAA LOC_Os12g29550.1 downstream_gene_variant ; 3254.0bp to feature; MODIFIER silent_mutation Average:61.476; most accessible tissue: Minghui63 flag leaf, score: 76.807 N N N N
vg1217621842 TA -> TAA LOC_Os12g29560.1 intron_variant ; MODIFIER silent_mutation Average:61.476; most accessible tissue: Minghui63 flag leaf, score: 76.807 N N N N
vg1217621842 TA -> TTTAA LOC_Os12g29570.1 upstream_gene_variant ; 2616.0bp to feature; MODIFIER silent_mutation Average:61.476; most accessible tissue: Minghui63 flag leaf, score: 76.807 N N N N
vg1217621842 TA -> TTTAA LOC_Os12g29570.2 upstream_gene_variant ; 2616.0bp to feature; MODIFIER silent_mutation Average:61.476; most accessible tissue: Minghui63 flag leaf, score: 76.807 N N N N
vg1217621842 TA -> TTTAA LOC_Os12g29550.1 downstream_gene_variant ; 3253.0bp to feature; MODIFIER silent_mutation Average:61.476; most accessible tissue: Minghui63 flag leaf, score: 76.807 N N N N
vg1217621842 TA -> TTTAA LOC_Os12g29560.1 intron_variant ; MODIFIER silent_mutation Average:61.476; most accessible tissue: Minghui63 flag leaf, score: 76.807 N N N N
vg1217621842 TA -> TAAAAAA LOC_Os12g29570.1 upstream_gene_variant ; 2615.0bp to feature; MODIFIER silent_mutation Average:61.476; most accessible tissue: Minghui63 flag leaf, score: 76.807 N N N N
vg1217621842 TA -> TAAAAAA LOC_Os12g29570.2 upstream_gene_variant ; 2615.0bp to feature; MODIFIER silent_mutation Average:61.476; most accessible tissue: Minghui63 flag leaf, score: 76.807 N N N N
vg1217621842 TA -> TAAAAAA LOC_Os12g29550.1 downstream_gene_variant ; 3254.0bp to feature; MODIFIER silent_mutation Average:61.476; most accessible tissue: Minghui63 flag leaf, score: 76.807 N N N N
vg1217621842 TA -> TAAAAAA LOC_Os12g29560.1 intron_variant ; MODIFIER silent_mutation Average:61.476; most accessible tissue: Minghui63 flag leaf, score: 76.807 N N N N
vg1217621842 TA -> T LOC_Os12g29570.1 upstream_gene_variant ; 2616.0bp to feature; MODIFIER silent_mutation Average:61.476; most accessible tissue: Minghui63 flag leaf, score: 76.807 N N N N
vg1217621842 TA -> T LOC_Os12g29570.2 upstream_gene_variant ; 2616.0bp to feature; MODIFIER silent_mutation Average:61.476; most accessible tissue: Minghui63 flag leaf, score: 76.807 N N N N
vg1217621842 TA -> T LOC_Os12g29550.1 downstream_gene_variant ; 3253.0bp to feature; MODIFIER silent_mutation Average:61.476; most accessible tissue: Minghui63 flag leaf, score: 76.807 N N N N
vg1217621842 TA -> T LOC_Os12g29560.1 intron_variant ; MODIFIER silent_mutation Average:61.476; most accessible tissue: Minghui63 flag leaf, score: 76.807 N N N N
vg1217621842 TA -> TTAA LOC_Os12g29570.1 upstream_gene_variant ; 2616.0bp to feature; MODIFIER silent_mutation Average:61.476; most accessible tissue: Minghui63 flag leaf, score: 76.807 N N N N
vg1217621842 TA -> TTAA LOC_Os12g29570.2 upstream_gene_variant ; 2616.0bp to feature; MODIFIER silent_mutation Average:61.476; most accessible tissue: Minghui63 flag leaf, score: 76.807 N N N N
vg1217621842 TA -> TTAA LOC_Os12g29550.1 downstream_gene_variant ; 3253.0bp to feature; MODIFIER silent_mutation Average:61.476; most accessible tissue: Minghui63 flag leaf, score: 76.807 N N N N
vg1217621842 TA -> TTAA LOC_Os12g29560.1 intron_variant ; MODIFIER silent_mutation Average:61.476; most accessible tissue: Minghui63 flag leaf, score: 76.807 N N N N
vg1217621842 TA -> AA LOC_Os12g29570.1 upstream_gene_variant ; 2617.0bp to feature; MODIFIER silent_mutation Average:61.476; most accessible tissue: Minghui63 flag leaf, score: 76.807 N N N N
vg1217621842 TA -> AA LOC_Os12g29570.2 upstream_gene_variant ; 2617.0bp to feature; MODIFIER silent_mutation Average:61.476; most accessible tissue: Minghui63 flag leaf, score: 76.807 N N N N
vg1217621842 TA -> AA LOC_Os12g29550.1 downstream_gene_variant ; 3252.0bp to feature; MODIFIER silent_mutation Average:61.476; most accessible tissue: Minghui63 flag leaf, score: 76.807 N N N N
vg1217621842 TA -> AA LOC_Os12g29560.1 intron_variant ; MODIFIER silent_mutation Average:61.476; most accessible tissue: Minghui63 flag leaf, score: 76.807 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217621842 NA 1.77E-16 Plant_height Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1217621842 NA 4.55E-06 mr1002 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842 NA 1.81E-06 mr1020 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842 NA 9.52E-06 mr1021 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842 NA 8.06E-08 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842 NA 9.04E-06 mr1057 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842 NA 9.12E-06 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842 NA 3.54E-07 mr1113 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842 NA 5.73E-09 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842 NA 8.58E-08 mr1116 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842 NA 3.76E-08 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842 NA 7.61E-08 mr1119 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842 6.13E-07 1.74E-09 mr1120 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842 NA 5.32E-07 mr1165 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842 2.31E-06 2.31E-06 mr1200 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842 NA 4.44E-07 mr1240 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842 NA 9.33E-06 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842 1.62E-06 1.07E-08 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842 NA 6.80E-06 mr1477 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842 NA 3.51E-08 mr1478 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842 NA 2.28E-06 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842 NA 7.41E-07 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842 NA 8.83E-07 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842 NA 4.44E-08 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842 8.74E-06 2.45E-07 mr1917 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842 NA 8.80E-07 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842 NA 5.70E-08 mr1971 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842 NA 6.14E-07 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842 9.40E-07 1.99E-08 mr1113_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842 NA 4.12E-08 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842 NA 1.41E-06 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842 NA 5.45E-08 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842 NA 7.12E-08 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842 NA 6.02E-06 mr1120_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842 NA 2.70E-07 mr1159_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842 NA 2.13E-07 mr1165_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842 NA 2.55E-07 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842 NA 4.18E-07 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842 NA 9.14E-07 mr1247_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842 NA 2.06E-07 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842 NA 4.80E-07 mr1478_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842 NA 9.17E-09 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842 NA 7.93E-07 mr1759_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842 NA 6.11E-06 mr1823_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842 NA 3.25E-06 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842 NA 1.69E-06 mr1861_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217621842 NA 9.58E-06 mr1971_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251