Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217570924:

Variant ID: vg1217570924 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 17570924
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.83, G: 0.17, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:

GCAACTTTATGGGAACGGAAGATATACTCCCTCCATTTTATACCCCATCTATCCCATAATATAAGGGATTTTGAGTGGATATAACATATTCTAATACAAT[T/G]
AATCTGGACATACCGTTTGTATAGATTTACTATAATAGGATGTATCACATCCACCCAAAATATCTTATATTATGGGACGGAGGAAGTACTATAAAAGTCC

Reverse complement sequence

GGACTTTTATAGTACTTCCTCCGTCCCATAATATAAGATATTTTGGGTGGATGTGATACATCCTATTATAGTAAATCTATACAAACGGTATGTCCAGATT[A/C]
ATTGTATTAGAATATGTTATATCCACTCAAAATCCCTTATATTATGGGATAGATGGGGTATAAAATGGAGGGAGTATATCTTCCGTTCCCATAAAGTTGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.00%	49.20%	0.28%	0.47%	NA
All Indica	2759	54.90%	44.70%	0.25%	0.18%	NA
All Japonica	1512	40.50%	59.50%	0.07%	0.00%	NA
Aus	269	55.00%	37.20%	1.49%	6.32%	NA
Indica I	595	83.40%	16.30%	0.34%	0.00%	NA
Indica II	465	32.00%	67.50%	0.43%	0.00%	NA
Indica III	913	46.40%	53.30%	0.00%	0.22%	NA
Indica Intermediate	786	56.60%	42.60%	0.38%	0.38%	NA
Temperate Japonica	767	7.40%	92.60%	0.00%	0.00%	NA
Tropical Japonica	504	81.00%	18.80%	0.20%	0.00%	NA
Japonica Intermediate	241	61.00%	39.00%	0.00%	0.00%	NA
VI/Aromatic	96	46.90%	53.10%	0.00%	0.00%	NA
Intermediate	90	50.00%	48.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1217570924	T -> DEL	N	N	silent_mutation	Average:52.632; most accessible tissue: Zhenshan97 panicle, score: 84.374	N	N	N	N
vg1217570924	T -> G	LOC_Os12g29520.1	downstream_gene_variant ; 613.0bp to feature; MODIFIER	silent_mutation	Average:52.632; most accessible tissue: Zhenshan97 panicle, score: 84.374	N	N	N	N
vg1217570924	T -> G	LOC_Os12g29520.2	downstream_gene_variant ; 613.0bp to feature; MODIFIER	silent_mutation	Average:52.632; most accessible tissue: Zhenshan97 panicle, score: 84.374	N	N	N	N
vg1217570924	T -> G	LOC_Os12g29520.3	downstream_gene_variant ; 613.0bp to feature; MODIFIER	silent_mutation	Average:52.632; most accessible tissue: Zhenshan97 panicle, score: 84.374	N	N	N	N
vg1217570924	T -> G	LOC_Os12g29520.4	downstream_gene_variant ; 613.0bp to feature; MODIFIER	silent_mutation	Average:52.632; most accessible tissue: Zhenshan97 panicle, score: 84.374	N	N	N	N
vg1217570924	T -> G	LOC_Os12g29520.5	downstream_gene_variant ; 613.0bp to feature; MODIFIER	silent_mutation	Average:52.632; most accessible tissue: Zhenshan97 panicle, score: 84.374	N	N	N	N
vg1217570924	T -> G	LOC_Os12g29510-LOC_Os12g29520	intergenic_region ; MODIFIER	silent_mutation	Average:52.632; most accessible tissue: Zhenshan97 panicle, score: 84.374	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1217570924	NA	5.08E-07	mr1388	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217570924	NA	1.92E-08	mr1543	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217570924	NA	1.00E-06	mr1742	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217570924	NA	8.21E-07	mr1835	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217570924	NA	1.10E-08	mr1042_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217570924	NA	7.90E-06	mr1043_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217570924	NA	2.65E-06	mr1091_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217570924	NA	2.86E-06	mr1096_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217570924	NA	7.17E-07	mr1291_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217570924	NA	8.51E-07	mr1479_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217570924	NA	1.76E-10	mr1502_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217570924	NA	7.95E-08	mr1526_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217570924	NA	1.05E-13	mr1543_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217570924	NA	2.63E-08	mr1680_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217570924	NA	9.58E-10	mr1742_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217570924	NA	3.60E-06	mr1747_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217570924	NA	4.13E-06	mr1759_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217570924	NA	8.03E-09	mr1808_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217570924	NA	8.97E-06	mr1814_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217570924	NA	2.65E-06	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217570924	NA	1.52E-06	mr1856_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217570924	NA	6.28E-11	mr1871_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217570924	NA	2.41E-07	mr1892_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217570924	NA	1.23E-07	mr1952_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251