\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217570924:

Variant ID: vg1217570924 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17570924
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.83, G: 0.17, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


GCAACTTTATGGGAACGGAAGATATACTCCCTCCATTTTATACCCCATCTATCCCATAATATAAGGGATTTTGAGTGGATATAACATATTCTAATACAAT[T/G]
AATCTGGACATACCGTTTGTATAGATTTACTATAATAGGATGTATCACATCCACCCAAAATATCTTATATTATGGGACGGAGGAAGTACTATAAAAGTCC

Reverse complement sequence

GGACTTTTATAGTACTTCCTCCGTCCCATAATATAAGATATTTTGGGTGGATGTGATACATCCTATTATAGTAAATCTATACAAACGGTATGTCCAGATT[A/C]
ATTGTATTAGAATATGTTATATCCACTCAAAATCCCTTATATTATGGGATAGATGGGGTATAAAATGGAGGGAGTATATCTTCCGTTCCCATAAAGTTGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.00% 49.20% 0.28% 0.47% NA
All Indica  2759 54.90% 44.70% 0.25% 0.18% NA
All Japonica  1512 40.50% 59.50% 0.07% 0.00% NA
Aus  269 55.00% 37.20% 1.49% 6.32% NA
Indica I  595 83.40% 16.30% 0.34% 0.00% NA
Indica II  465 32.00% 67.50% 0.43% 0.00% NA
Indica III  913 46.40% 53.30% 0.00% 0.22% NA
Indica Intermediate  786 56.60% 42.60% 0.38% 0.38% NA
Temperate Japonica  767 7.40% 92.60% 0.00% 0.00% NA
Tropical Japonica  504 81.00% 18.80% 0.20% 0.00% NA
Japonica Intermediate  241 61.00% 39.00% 0.00% 0.00% NA
VI/Aromatic  96 46.90% 53.10% 0.00% 0.00% NA
Intermediate  90 50.00% 48.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217570924 T -> DEL N N silent_mutation Average:52.632; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg1217570924 T -> G LOC_Os12g29520.1 downstream_gene_variant ; 613.0bp to feature; MODIFIER silent_mutation Average:52.632; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg1217570924 T -> G LOC_Os12g29520.2 downstream_gene_variant ; 613.0bp to feature; MODIFIER silent_mutation Average:52.632; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg1217570924 T -> G LOC_Os12g29520.3 downstream_gene_variant ; 613.0bp to feature; MODIFIER silent_mutation Average:52.632; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg1217570924 T -> G LOC_Os12g29520.4 downstream_gene_variant ; 613.0bp to feature; MODIFIER silent_mutation Average:52.632; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg1217570924 T -> G LOC_Os12g29520.5 downstream_gene_variant ; 613.0bp to feature; MODIFIER silent_mutation Average:52.632; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg1217570924 T -> G LOC_Os12g29510-LOC_Os12g29520 intergenic_region ; MODIFIER silent_mutation Average:52.632; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217570924 NA 5.08E-07 mr1388 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217570924 NA 1.92E-08 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217570924 NA 1.00E-06 mr1742 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217570924 NA 8.21E-07 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217570924 NA 1.10E-08 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217570924 NA 7.90E-06 mr1043_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217570924 NA 2.65E-06 mr1091_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217570924 NA 2.86E-06 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217570924 NA 7.17E-07 mr1291_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217570924 NA 8.51E-07 mr1479_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217570924 NA 1.76E-10 mr1502_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217570924 NA 7.95E-08 mr1526_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217570924 NA 1.05E-13 mr1543_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217570924 NA 2.63E-08 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217570924 NA 9.58E-10 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217570924 NA 3.60E-06 mr1747_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217570924 NA 4.13E-06 mr1759_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217570924 NA 8.03E-09 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217570924 NA 8.97E-06 mr1814_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217570924 NA 2.65E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217570924 NA 1.52E-06 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217570924 NA 6.28E-11 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217570924 NA 2.41E-07 mr1892_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217570924 NA 1.23E-07 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251