\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217552443:

Variant ID: vg1217552443 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17552443
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.90, C: 0.08, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


ACATATATATTAAGCGGTTAATATTTTAATTACATGTGTTAAGTCCTTTAAAATTTATTAAAATGCTCTCAAACTGCCACGTGGTGCTCTAATAAATTAG[A/C]
GCAAATATTAGAAATTCTAAGAAAAAAAAGCAAAGTATCCACTGCTTAATTTTCACTTAAATCGGGACATCCAATATTATAAACTGTTAGATTAAATTAA

Reverse complement sequence

TTAATTTAATCTAACAGTTTATAATATTGGATGTCCCGATTTAAGTGAAAATTAAGCAGTGGATACTTTGCTTTTTTTTCTTAGAATTTCTAATATTTGC[T/G]
CTAATTTATTAGAGCACCACGTGGCAGTTTGAGAGCATTTTAATAAATTTTAAAGGACTTAACACATGTAATTAAAATATTAACCGCTTAATATATATGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.60% 28.90% 0.63% 14.94% NA
All Indica  2759 59.30% 39.00% 0.54% 1.16% NA
All Japonica  1512 46.00% 13.00% 0.40% 40.61% NA
Aus  269 70.30% 24.90% 0.74% 4.09% NA
Indica I  595 20.70% 77.00% 0.84% 1.51% NA
Indica II  465 77.60% 21.90% 0.22% 0.22% NA
Indica III  913 75.90% 23.30% 0.22% 0.55% NA
Indica Intermediate  786 58.30% 38.70% 0.89% 2.16% NA
Temperate Japonica  767 78.50% 0.80% 0.13% 20.60% NA
Tropical Japonica  504 3.00% 25.80% 0.60% 70.63% NA
Japonica Intermediate  241 32.80% 24.90% 0.83% 41.49% NA
VI/Aromatic  96 51.00% 7.30% 6.25% 35.42% NA
Intermediate  90 63.30% 18.90% 1.11% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217552443 A -> C LOC_Os12g29510-LOC_Os12g29520 intergenic_region ; MODIFIER silent_mutation Average:14.482; most accessible tissue: Zhenshan97 root, score: 22.162 N N N N
vg1217552443 A -> DEL N N silent_mutation Average:14.482; most accessible tissue: Zhenshan97 root, score: 22.162 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217552443 NA 1.10E-15 Grain_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1217552443 NA 5.80E-11 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552443 NA 9.88E-06 mr1139 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552443 NA 1.09E-07 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552443 NA 3.10E-10 mr1178 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552443 NA 6.85E-06 mr1227 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552443 NA 1.44E-07 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552443 NA 4.52E-06 mr1291 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552443 NA 1.34E-06 mr1335 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552443 NA 2.41E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552443 6.90E-06 6.90E-06 mr1513 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552443 NA 1.26E-06 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552443 NA 9.98E-13 mr1533 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552443 3.72E-06 1.63E-06 mr1590 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552443 NA 2.39E-08 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552443 NA 7.35E-07 mr1660 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552443 NA 2.09E-07 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552443 NA 5.65E-07 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552443 NA 6.52E-07 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552443 5.63E-06 4.77E-07 mr1755 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552443 NA 5.09E-09 mr1800 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552443 NA 1.59E-07 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552443 NA 1.07E-06 mr1958 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552443 NA 9.86E-06 mr1975 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552443 NA 4.16E-11 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552443 NA 5.58E-07 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251