Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217552443:

Variant ID: vg1217552443 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 17552443
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.90, C: 0.08, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:

ACATATATATTAAGCGGTTAATATTTTAATTACATGTGTTAAGTCCTTTAAAATTTATTAAAATGCTCTCAAACTGCCACGTGGTGCTCTAATAAATTAG[A/C]
GCAAATATTAGAAATTCTAAGAAAAAAAAGCAAAGTATCCACTGCTTAATTTTCACTTAAATCGGGACATCCAATATTATAAACTGTTAGATTAAATTAA

Reverse complement sequence

TTAATTTAATCTAACAGTTTATAATATTGGATGTCCCGATTTAAGTGAAAATTAAGCAGTGGATACTTTGCTTTTTTTTCTTAGAATTTCTAATATTTGC[T/G]
CTAATTTATTAGAGCACCACGTGGCAGTTTGAGAGCATTTTAATAAATTTTAAAGGACTTAACACATGTAATTAAAATATTAACCGCTTAATATATATGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.60%	28.90%	0.63%	14.94%	NA
All Indica	2759	59.30%	39.00%	0.54%	1.16%	NA
All Japonica	1512	46.00%	13.00%	0.40%	40.61%	NA
Aus	269	70.30%	24.90%	0.74%	4.09%	NA
Indica I	595	20.70%	77.00%	0.84%	1.51%	NA
Indica II	465	77.60%	21.90%	0.22%	0.22%	NA
Indica III	913	75.90%	23.30%	0.22%	0.55%	NA
Indica Intermediate	786	58.30%	38.70%	0.89%	2.16%	NA
Temperate Japonica	767	78.50%	0.80%	0.13%	20.60%	NA
Tropical Japonica	504	3.00%	25.80%	0.60%	70.63%	NA
Japonica Intermediate	241	32.80%	24.90%	0.83%	41.49%	NA
VI/Aromatic	96	51.00%	7.30%	6.25%	35.42%	NA
Intermediate	90	63.30%	18.90%	1.11%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1217552443	A -> C	LOC_Os12g29510-LOC_Os12g29520	intergenic_region ; MODIFIER	silent_mutation	Average:14.482; most accessible tissue: Zhenshan97 root, score: 22.162	N	N	N	N
vg1217552443	A -> DEL	N	N	silent_mutation	Average:14.482; most accessible tissue: Zhenshan97 root, score: 22.162	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1217552443	NA	1.10E-15	Grain_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1217552443	NA	5.80E-11	mr1132	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552443	NA	9.88E-06	mr1139	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552443	NA	1.09E-07	mr1155	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552443	NA	3.10E-10	mr1178	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552443	NA	6.85E-06	mr1227	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552443	NA	1.44E-07	mr1272	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552443	NA	4.52E-06	mr1291	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552443	NA	1.34E-06	mr1335	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552443	NA	2.41E-06	mr1502	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552443	6.90E-06	6.90E-06	mr1513	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552443	NA	1.26E-06	mr1518	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552443	NA	9.98E-13	mr1533	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552443	3.72E-06	1.63E-06	mr1590	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552443	NA	2.39E-08	mr1660	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552443	NA	7.35E-07	mr1660	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552443	NA	2.09E-07	mr1676	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552443	NA	5.65E-07	mr1696	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552443	NA	6.52E-07	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552443	5.63E-06	4.77E-07	mr1755	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552443	NA	5.09E-09	mr1800	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552443	NA	1.59E-07	mr1916	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552443	NA	1.07E-06	mr1958	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552443	NA	9.86E-06	mr1975	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552443	NA	4.16E-11	mr1980	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217552443	NA	5.58E-07	mr1952_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251