Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217551932:

Variant ID: vg1217551932 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 17551932
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.83, A: 0.17, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:

CAAAGACAAGGGTGTTATAAGGGAGTTTAAGACCCTCTTTTTTTTCTAGATTCCATAGTTGGATTTTTGTTTGCACGCTTTCCAAGTTTTTAAATGGTGT[C/A]
TTTTTTAAACCACATTTTAACTTTTTAGAAGTCAATTTATTTGTTTATACCCTCAAATAGCTACAACATAAATCAGATAATTCATCAATTTCAGCTGTCC

Reverse complement sequence

GGACAGCTGAAATTGATGAATTATCTGATTTATGTTGTAGCTATTTGAGGGTATAAACAAATAAATTGACTTCTAAAAAGTTAAAATGTGGTTTAAAAAA[G/T]
ACACCATTTAAAAACTTGGAAAGCGTGCAAACAAAAATCCAACTATGGAATCTAGAAAAAAAAGAGGGTCTTAAACTCCCTTATAACACCCTTGTCTTTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.20%	29.00%	1.04%	14.73%	NA
All Indica	2759	58.60%	39.30%	1.05%	1.01%	NA
All Japonica	1512	46.30%	13.00%	0.66%	40.01%	NA
Aus	269	70.30%	24.90%	1.12%	3.72%	NA
Indica I	595	20.80%	76.60%	1.34%	1.18%	NA
Indica II	465	77.60%	21.90%	0.22%	0.22%	NA
Indica III	913	74.20%	23.90%	1.42%	0.55%	NA
Indica Intermediate	786	58.00%	39.20%	0.89%	1.91%	NA
Temperate Japonica	767	78.50%	1.00%	0.52%	19.95%	NA
Tropical Japonica	504	3.60%	25.60%	0.40%	70.44%	NA
Japonica Intermediate	241	33.20%	24.90%	1.66%	40.25%	NA
VI/Aromatic	96	47.90%	6.20%	5.21%	40.62%	NA
Intermediate	90	62.20%	20.00%	2.22%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1217551932	C -> DEL	N	N	silent_mutation	Average:17.606; most accessible tissue: Minghui63 young leaf, score: 23.613	N	N	N	N
vg1217551932	C -> A	LOC_Os12g29510-LOC_Os12g29520	intergenic_region ; MODIFIER	silent_mutation	Average:17.606; most accessible tissue: Minghui63 young leaf, score: 23.613	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1217551932	NA	7.68E-06	mr1039	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551932	NA	2.83E-06	mr1139	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551932	2.95E-06	1.40E-08	mr1155	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551932	NA	7.63E-09	mr1227	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551932	NA	4.10E-06	mr1227	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551932	NA	1.04E-07	mr1272	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551932	NA	1.11E-06	mr1335	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551932	NA	1.56E-06	mr1461	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551932	NA	6.71E-06	mr1502	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551932	NA	4.22E-07	mr1511	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551932	1.38E-06	NA	mr1513	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551932	2.73E-06	2.73E-06	mr1513	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551932	4.79E-06	5.51E-09	mr1533	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551932	1.03E-06	9.08E-07	mr1590	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551932	NA	3.48E-12	mr1660	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551932	NA	9.20E-07	mr1660	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551932	NA	6.88E-07	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551932	NA	2.97E-07	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551932	1.10E-06	2.10E-07	mr1755	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551932	5.30E-06	7.04E-07	mr1755	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551932	8.17E-06	8.52E-06	mr1811	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551932	NA	5.44E-06	mr1835	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551932	NA	3.78E-09	mr1866	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551932	2.92E-06	NA	mr1964	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551932	3.08E-06	3.08E-06	mr1964	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551932	NA	6.42E-06	mr1498_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251