\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217551932:

Variant ID: vg1217551932 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17551932
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.83, A: 0.17, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:


CAAAGACAAGGGTGTTATAAGGGAGTTTAAGACCCTCTTTTTTTTCTAGATTCCATAGTTGGATTTTTGTTTGCACGCTTTCCAAGTTTTTAAATGGTGT[C/A]
TTTTTTAAACCACATTTTAACTTTTTAGAAGTCAATTTATTTGTTTATACCCTCAAATAGCTACAACATAAATCAGATAATTCATCAATTTCAGCTGTCC

Reverse complement sequence

GGACAGCTGAAATTGATGAATTATCTGATTTATGTTGTAGCTATTTGAGGGTATAAACAAATAAATTGACTTCTAAAAAGTTAAAATGTGGTTTAAAAAA[G/T]
ACACCATTTAAAAACTTGGAAAGCGTGCAAACAAAAATCCAACTATGGAATCTAGAAAAAAAAGAGGGTCTTAAACTCCCTTATAACACCCTTGTCTTTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.20% 29.00% 1.04% 14.73% NA
All Indica  2759 58.60% 39.30% 1.05% 1.01% NA
All Japonica  1512 46.30% 13.00% 0.66% 40.01% NA
Aus  269 70.30% 24.90% 1.12% 3.72% NA
Indica I  595 20.80% 76.60% 1.34% 1.18% NA
Indica II  465 77.60% 21.90% 0.22% 0.22% NA
Indica III  913 74.20% 23.90% 1.42% 0.55% NA
Indica Intermediate  786 58.00% 39.20% 0.89% 1.91% NA
Temperate Japonica  767 78.50% 1.00% 0.52% 19.95% NA
Tropical Japonica  504 3.60% 25.60% 0.40% 70.44% NA
Japonica Intermediate  241 33.20% 24.90% 1.66% 40.25% NA
VI/Aromatic  96 47.90% 6.20% 5.21% 40.62% NA
Intermediate  90 62.20% 20.00% 2.22% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217551932 C -> DEL N N silent_mutation Average:17.606; most accessible tissue: Minghui63 young leaf, score: 23.613 N N N N
vg1217551932 C -> A LOC_Os12g29510-LOC_Os12g29520 intergenic_region ; MODIFIER silent_mutation Average:17.606; most accessible tissue: Minghui63 young leaf, score: 23.613 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217551932 NA 7.68E-06 mr1039 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551932 NA 2.83E-06 mr1139 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551932 2.95E-06 1.40E-08 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551932 NA 7.63E-09 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551932 NA 4.10E-06 mr1227 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551932 NA 1.04E-07 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551932 NA 1.11E-06 mr1335 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551932 NA 1.56E-06 mr1461 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551932 NA 6.71E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551932 NA 4.22E-07 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551932 1.38E-06 NA mr1513 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551932 2.73E-06 2.73E-06 mr1513 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551932 4.79E-06 5.51E-09 mr1533 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551932 1.03E-06 9.08E-07 mr1590 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551932 NA 3.48E-12 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551932 NA 9.20E-07 mr1660 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551932 NA 6.88E-07 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551932 NA 2.97E-07 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551932 1.10E-06 2.10E-07 mr1755 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551932 5.30E-06 7.04E-07 mr1755 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551932 8.17E-06 8.52E-06 mr1811 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551932 NA 5.44E-06 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551932 NA 3.78E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551932 2.92E-06 NA mr1964 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551932 3.08E-06 3.08E-06 mr1964 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551932 NA 6.42E-06 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251