\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217551780:

Variant ID: vg1217551780 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17551780
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTTAAGCTGAAACCGAGAGTTGATTACAGAATAATTATAATGTATCGTGTTATGTCATATTTGGATTTTGTACTATTTATTCATATAGGTGAAAGAAAT[T/C]
ATTATATTATAAATCTGAGCACAATATTAACGAATATCAAGAGAACTCTTACAAAGACAAGGGTGTTATAAGGGAGTTTAAGACCCTCTTTTTTTTCTAG

Reverse complement sequence

CTAGAAAAAAAAGAGGGTCTTAAACTCCCTTATAACACCCTTGTCTTTGTAAGAGTTCTCTTGATATTCGTTAATATTGTGCTCAGATTTATAATATAAT[A/G]
ATTTCTTTCACCTATATGAATAAATAGTACAAAATCCAAATATGACATAACACGATACATTATAATTATTCTGTAATCAACTCTCGGTTTCAGCTTAAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.10% 14.60% 0.38% 14.83% NA
All Indica  2759 98.00% 0.70% 0.11% 1.20% NA
All Japonica  1512 16.10% 43.10% 0.33% 40.41% NA
Aus  269 95.50% 0.00% 1.86% 2.60% NA
Indica I  595 98.00% 0.20% 0.17% 1.68% NA
Indica II  465 97.20% 2.60% 0.00% 0.22% NA
Indica III  913 99.30% 0.10% 0.00% 0.55% NA
Indica Intermediate  786 97.10% 0.50% 0.25% 2.16% NA
Temperate Japonica  767 2.70% 76.70% 0.39% 20.21% NA
Tropical Japonica  504 28.60% 0.80% 0.40% 70.24% NA
Japonica Intermediate  241 32.80% 24.90% 0.00% 42.32% NA
VI/Aromatic  96 55.20% 0.00% 4.17% 40.62% NA
Intermediate  90 62.20% 24.40% 1.11% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217551780 T -> C LOC_Os12g29510-LOC_Os12g29520 intergenic_region ; MODIFIER silent_mutation Average:16.702; most accessible tissue: Minghui63 young leaf, score: 20.156 N N N N
vg1217551780 T -> DEL N N silent_mutation Average:16.702; most accessible tissue: Minghui63 young leaf, score: 20.156 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217551780 NA 8.16E-10 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551780 NA 7.24E-11 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551780 NA 4.81E-26 mr1223 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551780 NA 2.47E-09 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551780 NA 5.01E-11 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551780 NA 3.35E-34 mr1350 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551780 NA 5.18E-14 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551780 NA 5.18E-14 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551780 NA 7.26E-19 mr1529 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551780 2.65E-06 NA mr1536 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551780 NA 1.49E-39 mr1601 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551780 NA 5.46E-12 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551780 NA 5.10E-16 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551780 NA 1.64E-08 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551780 NA 5.51E-07 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551780 NA 3.60E-07 mr1819 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551780 NA 7.31E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551780 NA 2.13E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217551780 NA 1.44E-14 mr1790_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251