\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217549799:

Variant ID: vg1217549799 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17549799
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AACTTAAAGCTCTATATGTAAAATAATTGAAAACAACACAATTTAGTTGTGTATTTTTAAGCAGATATGATTTAGTTTTAATATGTCTGAGATTAAGATT[C/A]
TCATCTTTTTTTTAATTGTTAGAACTATTTCAATAGTATATGATAAGTGGGCAACCTAAATGTTACATAAATGTAAAAAATAATTATGAAAAATATTTCA

Reverse complement sequence

TGAAATATTTTTCATAATTATTTTTTACATTTATGTAACATTTAGGTTGCCCACTTATCATATACTATTGAAATAGTTCTAACAATTAAAAAAAAGATGA[G/T]
AATCTTAATCTCAGACATATTAAAACTAAATCATATCTGCTTAAAAATACACAACTAAATTGTGTTGTTTTCAATTATTTTACATATAGAGCTTTAAGTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.70% 1.00% 9.14% 15.17% NA
All Indica  2759 75.20% 1.60% 9.24% 13.92% NA
All Japonica  1512 72.40% 0.00% 6.68% 20.97% NA
Aus  269 79.60% 0.00% 18.59% 1.86% NA
Indica I  595 46.10% 0.30% 13.95% 39.66% NA
Indica II  465 83.20% 1.10% 11.61% 4.09% NA
Indica III  913 90.70% 1.80% 4.16% 3.40% NA
Indica Intermediate  786 74.60% 2.80% 10.18% 12.47% NA
Temperate Japonica  767 87.50% 0.00% 0.39% 12.13% NA
Tropical Japonica  504 49.20% 0.00% 16.67% 34.13% NA
Japonica Intermediate  241 72.60% 0.00% 5.81% 21.58% NA
VI/Aromatic  96 79.20% 0.00% 20.83% 0.00% NA
Intermediate  90 80.00% 1.10% 6.67% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217549799 C -> DEL N N silent_mutation Average:11.504; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg1217549799 C -> A LOC_Os12g29510-LOC_Os12g29520 intergenic_region ; MODIFIER silent_mutation Average:11.504; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217549799 3.95E-07 3.95E-07 mr1321 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217549799 2.56E-06 2.53E-06 mr1322 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217549799 4.60E-07 4.60E-07 mr1323 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217549799 1.38E-07 1.74E-08 mr1324 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217549799 1.08E-08 1.39E-09 mr1325 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217549799 1.35E-07 1.95E-08 mr1326 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217549799 3.80E-06 6.94E-07 mr1335 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217549799 1.00E-06 3.11E-08 mr1336 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217549799 8.63E-06 8.63E-06 mr1527 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217549799 NA 8.83E-06 mr1532 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217549799 1.63E-06 1.63E-06 mr1540 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217549799 NA 1.21E-06 mr1553 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217549799 2.47E-06 4.33E-06 mr1621 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217549799 1.69E-06 3.93E-07 mr1732 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251