Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217549799:

Variant ID: vg1217549799 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 17549799
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AACTTAAAGCTCTATATGTAAAATAATTGAAAACAACACAATTTAGTTGTGTATTTTTAAGCAGATATGATTTAGTTTTAATATGTCTGAGATTAAGATT[C/A]
TCATCTTTTTTTTAATTGTTAGAACTATTTCAATAGTATATGATAAGTGGGCAACCTAAATGTTACATAAATGTAAAAAATAATTATGAAAAATATTTCA

Reverse complement sequence

TGAAATATTTTTCATAATTATTTTTTACATTTATGTAACATTTAGGTTGCCCACTTATCATATACTATTGAAATAGTTCTAACAATTAAAAAAAAGATGA[G/T]
AATCTTAATCTCAGACATATTAAAACTAAATCATATCTGCTTAAAAATACACAACTAAATTGTGTTGTTTTCAATTATTTTACATATAGAGCTTTAAGTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.70%	1.00%	9.14%	15.17%	NA
All Indica	2759	75.20%	1.60%	9.24%	13.92%	NA
All Japonica	1512	72.40%	0.00%	6.68%	20.97%	NA
Aus	269	79.60%	0.00%	18.59%	1.86%	NA
Indica I	595	46.10%	0.30%	13.95%	39.66%	NA
Indica II	465	83.20%	1.10%	11.61%	4.09%	NA
Indica III	913	90.70%	1.80%	4.16%	3.40%	NA
Indica Intermediate	786	74.60%	2.80%	10.18%	12.47%	NA
Temperate Japonica	767	87.50%	0.00%	0.39%	12.13%	NA
Tropical Japonica	504	49.20%	0.00%	16.67%	34.13%	NA
Japonica Intermediate	241	72.60%	0.00%	5.81%	21.58%	NA
VI/Aromatic	96	79.20%	0.00%	20.83%	0.00%	NA
Intermediate	90	80.00%	1.10%	6.67%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1217549799	C -> DEL	N	N	silent_mutation	Average:11.504; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg1217549799	C -> A	LOC_Os12g29510-LOC_Os12g29520	intergenic_region ; MODIFIER	silent_mutation	Average:11.504; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1217549799	3.95E-07	3.95E-07	mr1321	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217549799	2.56E-06	2.53E-06	mr1322	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217549799	4.60E-07	4.60E-07	mr1323	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217549799	1.38E-07	1.74E-08	mr1324	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217549799	1.08E-08	1.39E-09	mr1325	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217549799	1.35E-07	1.95E-08	mr1326	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217549799	3.80E-06	6.94E-07	mr1335	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217549799	1.00E-06	3.11E-08	mr1336	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217549799	8.63E-06	8.63E-06	mr1527	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217549799	NA	8.83E-06	mr1532	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217549799	1.63E-06	1.63E-06	mr1540	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217549799	NA	1.21E-06	mr1553	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217549799	2.47E-06	4.33E-06	mr1621	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217549799	1.69E-06	3.93E-07	mr1732	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251