Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217533657:

Variant ID: vg1217533657 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 17533657
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:

ATTATATGTCTATAATCTCAACAGAATGCGTGCTTGTTAACTCGCTACAAAAATGCCTAAGCTTGTGTAAATGAATGTACAGAATATGAATAATCCTTCA[A/G]
AAGCCAAGGGCAGTGTGTCTAACTAAAGGAAAACAGGAAAGAAGGAAAGGAGACAAGAAAAAAAAAGATGAGAGATGGCAAAGATGAATGGGCCACCTAC

Reverse complement sequence

GTAGGTGGCCCATTCATCTTTGCCATCTCTCATCTTTTTTTTTCTTGTCTCCTTTCCTTCTTTCCTGTTTTCCTTTAGTTAGACACACTGCCCTTGGCTT[T/C]
TGAAGGATTATTCATATTCTGTACATTCATTTACACAAGCTTAGGCATTTTTGTAGCGAGTTAACAAGCACGCATTCTGTTGAGATTATAGACATATAAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.50%	12.50%	0.17%	0.80%	NA
All Indica	2759	96.30%	2.40%	0.11%	1.27%	NA
All Japonica	1512	68.80%	30.80%	0.20%	0.20%	NA
Aus	269	92.20%	7.80%	0.00%	0.00%	NA
Indica I	595	94.10%	0.00%	0.50%	5.38%	NA
Indica II	465	90.10%	9.90%	0.00%	0.00%	NA
Indica III	913	99.30%	0.50%	0.00%	0.11%	NA
Indica Intermediate	786	98.00%	1.80%	0.00%	0.25%	NA
Temperate Japonica	767	94.40%	5.10%	0.13%	0.39%	NA
Tropical Japonica	504	26.60%	73.00%	0.40%	0.00%	NA
Japonica Intermediate	241	75.90%	24.10%	0.00%	0.00%	NA
VI/Aromatic	96	76.00%	21.90%	2.08%	0.00%	NA
Intermediate	90	76.70%	23.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1217533657	A -> DEL	N	N	silent_mutation	Average:46.875; most accessible tissue: Zhenshan97 flower, score: 69.775	N	N	N	N
vg1217533657	A -> G	LOC_Os12g29500.1	downstream_gene_variant ; 3651.0bp to feature; MODIFIER	silent_mutation	Average:46.875; most accessible tissue: Zhenshan97 flower, score: 69.775	N	N	N	N
vg1217533657	A -> G	LOC_Os12g29480-LOC_Os12g29500	intergenic_region ; MODIFIER	silent_mutation	Average:46.875; most accessible tissue: Zhenshan97 flower, score: 69.775	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1217533657	7.47E-06	NA	mr1022	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217533657	NA	4.86E-06	mr1269	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217533657	NA	4.47E-07	mr1388	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217533657	NA	6.15E-06	mr1388	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217533657	NA	5.02E-09	mr1408	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217533657	NA	7.30E-07	mr1543	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217533657	NA	2.25E-08	mr1543	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217533657	NA	5.48E-06	mr1602	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217533657	NA	7.97E-07	mr1642	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217533657	NA	2.06E-06	mr1642	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217533657	NA	1.93E-08	mr1742	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217533657	NA	9.07E-08	mr1742	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217533657	2.28E-06	2.28E-06	mr1815	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217533657	NA	1.34E-06	mr1078_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251