\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217533657:

Variant ID: vg1217533657 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17533657
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:


ATTATATGTCTATAATCTCAACAGAATGCGTGCTTGTTAACTCGCTACAAAAATGCCTAAGCTTGTGTAAATGAATGTACAGAATATGAATAATCCTTCA[A/G]
AAGCCAAGGGCAGTGTGTCTAACTAAAGGAAAACAGGAAAGAAGGAAAGGAGACAAGAAAAAAAAAGATGAGAGATGGCAAAGATGAATGGGCCACCTAC

Reverse complement sequence

GTAGGTGGCCCATTCATCTTTGCCATCTCTCATCTTTTTTTTTCTTGTCTCCTTTCCTTCTTTCCTGTTTTCCTTTAGTTAGACACACTGCCCTTGGCTT[T/C]
TGAAGGATTATTCATATTCTGTACATTCATTTACACAAGCTTAGGCATTTTTGTAGCGAGTTAACAAGCACGCATTCTGTTGAGATTATAGACATATAAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.50% 12.50% 0.17% 0.80% NA
All Indica  2759 96.30% 2.40% 0.11% 1.27% NA
All Japonica  1512 68.80% 30.80% 0.20% 0.20% NA
Aus  269 92.20% 7.80% 0.00% 0.00% NA
Indica I  595 94.10% 0.00% 0.50% 5.38% NA
Indica II  465 90.10% 9.90% 0.00% 0.00% NA
Indica III  913 99.30% 0.50% 0.00% 0.11% NA
Indica Intermediate  786 98.00% 1.80% 0.00% 0.25% NA
Temperate Japonica  767 94.40% 5.10% 0.13% 0.39% NA
Tropical Japonica  504 26.60% 73.00% 0.40% 0.00% NA
Japonica Intermediate  241 75.90% 24.10% 0.00% 0.00% NA
VI/Aromatic  96 76.00% 21.90% 2.08% 0.00% NA
Intermediate  90 76.70% 23.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217533657 A -> DEL N N silent_mutation Average:46.875; most accessible tissue: Zhenshan97 flower, score: 69.775 N N N N
vg1217533657 A -> G LOC_Os12g29500.1 downstream_gene_variant ; 3651.0bp to feature; MODIFIER silent_mutation Average:46.875; most accessible tissue: Zhenshan97 flower, score: 69.775 N N N N
vg1217533657 A -> G LOC_Os12g29480-LOC_Os12g29500 intergenic_region ; MODIFIER silent_mutation Average:46.875; most accessible tissue: Zhenshan97 flower, score: 69.775 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217533657 7.47E-06 NA mr1022 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217533657 NA 4.86E-06 mr1269 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217533657 NA 4.47E-07 mr1388 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217533657 NA 6.15E-06 mr1388 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217533657 NA 5.02E-09 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217533657 NA 7.30E-07 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217533657 NA 2.25E-08 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217533657 NA 5.48E-06 mr1602 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217533657 NA 7.97E-07 mr1642 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217533657 NA 2.06E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217533657 NA 1.93E-08 mr1742 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217533657 NA 9.07E-08 mr1742 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217533657 2.28E-06 2.28E-06 mr1815 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217533657 NA 1.34E-06 mr1078_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251