Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1217503545:

Variant ID: vg1217503545 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 17503545
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:

TGTGATATATAATTGACTACTTTTAGATGTTTATGAGTAAAGCTCATAGTATGATCCAAAAATAGTATAATGTCTACAATTATCTTGTTGAGCAACCGGG[T/C]
TTTGGGTTTTGGGCCTTGTAATTGTGTTGTTCAAAAGCCAGATCGAGTTGTGTCGCGACTCCGCCCAAATCGACTGTTTATCCATACCTATCAGAAGATC

Reverse complement sequence

GATCTTCTGATAGGTATGGATAAACAGTCGATTTGGGCGGAGTCGCGACACAACTCGATCTGGCTTTTGAACAACACAATTACAAGGCCCAAAACCCAAA[A/G]
CCCGGTTGCTCAACAAGATAATTGTAGACATTATACTATTTTTGGATCATACTATGAGCTTTACTCATAAACATCTAAAAGTAGTCAATTATATATCACA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.20%	5.10%	0.19%	6.58%	NA
All Indica	2759	95.30%	2.00%	0.07%	2.68%	NA
All Japonica	1512	82.70%	9.90%	0.07%	7.41%	NA
Aus	269	52.00%	0.40%	1.86%	45.72%	NA
Indica I	595	92.10%	0.00%	0.17%	7.73%	NA
Indica II	465	90.50%	9.50%	0.00%	0.00%	NA
Indica III	913	99.20%	0.30%	0.00%	0.44%	NA
Indica Intermediate	786	95.80%	1.00%	0.13%	3.05%	NA
Temperate Japonica	767	87.10%	0.10%	0.00%	12.78%	NA
Tropical Japonica	504	72.40%	27.40%	0.20%	0.00%	NA
Japonica Intermediate	241	90.00%	4.10%	0.00%	5.81%	NA
VI/Aromatic	96	75.00%	25.00%	0.00%	0.00%	NA
Intermediate	90	85.60%	11.10%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1217503545	T -> C	LOC_Os12g29450.1	upstream_gene_variant ; 3225.0bp to feature; MODIFIER	silent_mutation	Average:36.451; most accessible tissue: Callus, score: 62.677	N	N	N	N
vg1217503545	T -> C	LOC_Os12g29450-LOC_Os12g29470	intergenic_region ; MODIFIER	silent_mutation	Average:36.451; most accessible tissue: Callus, score: 62.677	N	N	N	N
vg1217503545	T -> DEL	N	N	silent_mutation	Average:36.451; most accessible tissue: Callus, score: 62.677	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1217503545	3.33E-06	NA	mr1076	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217503545	NA	5.42E-06	mr1076	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217503545	5.21E-07	NA	mr1082	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217503545	NA	8.64E-07	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217503545	7.83E-11	NA	mr1083	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217503545	3.65E-07	3.23E-11	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217503545	4.59E-08	NA	mr1085	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217503545	6.01E-06	NA	mr1086	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217503545	4.56E-06	NA	mr1088	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217503545	8.29E-07	NA	mr1103	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217503545	6.48E-06	NA	mr1104	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217503545	6.10E-06	NA	mr1145	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217503545	9.19E-07	NA	mr1204	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217503545	5.85E-09	NA	mr1226	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217503545	NA	5.31E-09	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217503545	NA	6.70E-06	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217503545	NA	1.21E-07	mr1408	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217503545	8.45E-07	NA	mr1411	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217503545	6.45E-06	NA	mr1437	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217503545	NA	1.97E-06	mr1443	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217503545	3.18E-06	2.20E-09	mr1471	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217503545	8.82E-08	NA	mr1560	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217503545	NA	4.49E-06	mr1560	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217503545	NA	6.21E-07	mr1642	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217503545	1.51E-06	NA	mr1949	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217503545	NA	6.29E-06	mr1949	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217503545	2.82E-07	2.82E-07	mr1076_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217503545	NA	5.67E-06	mr1082_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217503545	4.97E-09	NA	mr1083_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217503545	NA	1.77E-08	mr1083_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217503545	9.66E-06	NA	mr1103_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217503545	8.04E-09	NA	mr1104_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217503545	NA	6.38E-07	mr1104_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217503545	4.48E-09	NA	mr1107_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217503545	NA	8.58E-07	mr1107_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217503545	3.21E-10	NA	mr1226_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217503545	NA	3.97E-09	mr1226_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217503545	NA	2.82E-08	mr1364_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217503545	NA	1.10E-08	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217503545	NA	8.49E-06	mr1408_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251