\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217490773:

Variant ID: vg1217490773 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17490773
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:


GACGGTGCCTTGTGGCCGTTTCTCGTGGTCGTCCAAGCGTTTCATGAGGAGGCCCAGCTTGGCAGCAAGTAATTCCGTCTCTTTGACAGTGTGCATGCCT[C/T]
GCTGACGGGTCTGGAGTCGTTCCTCGCTCCAACCCATATTGGAGACCATCTTCTCTATTAGATCAACGGCTCCTTAAACCGTTTTAGAGAAGAACGCTCC

Reverse complement sequence

GGAGCGTTCTTCTCTAAAACGGTTTAAGGAGCCGTTGATCTAATAGAGAAGATGGTCTCCAATATGGGTTGGAGCGAGGAACGACTCCAGACCCGTCAGC[G/A]
AGGCATGCACACTGTCAAAGAGACGGAATTACTTGCTGCCAAGCTGGGCCTCCTCATGAAACGCTTGGACGACCACGAGAAACGGCCACAAGGCACCGTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.30% 4.70% 0.76% 3.32% NA
All Indica  2759 96.30% 2.00% 0.25% 1.38% NA
All Japonica  1512 84.70% 8.50% 0.79% 5.95% NA
Aus  269 83.30% 0.40% 5.58% 10.78% NA
Indica I  595 95.80% 0.00% 0.50% 3.70% NA
Indica II  465 90.50% 9.20% 0.00% 0.22% NA
Indica III  913 99.20% 0.40% 0.11% 0.22% NA
Indica Intermediate  786 96.80% 1.10% 0.38% 1.65% NA
Temperate Japonica  767 91.10% 0.10% 0.39% 8.34% NA
Tropical Japonica  504 72.40% 23.60% 1.19% 2.78% NA
Japonica Intermediate  241 90.00% 3.70% 1.24% 4.98% NA
VI/Aromatic  96 74.00% 25.00% 1.04% 0.00% NA
Intermediate  90 87.80% 11.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217490773 C -> DEL LOC_Os12g29440.1 N frameshift_variant Average:48.551; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 N N N N
vg1217490773 C -> T LOC_Os12g29440.1 missense_variant ; p.Arg17Gln; MODERATE nonsynonymous_codon ; R17Q Average:48.551; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 benign 0.469 DELETERIOUS 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217490773 NA 9.18E-07 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217490773 NA 7.05E-08 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217490773 2.32E-08 4.95E-13 mr1083 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217490773 2.19E-06 2.20E-06 mr1085 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217490773 NA 8.20E-06 mr1086 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217490773 NA 2.70E-10 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217490773 NA 1.58E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217490773 8.14E-06 1.75E-07 mr1408 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217490773 NA 3.84E-07 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217490773 NA 5.65E-07 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217490773 NA 9.80E-07 mr1560 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217490773 NA 4.57E-07 mr1949 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217490773 2.03E-08 2.03E-08 mr1076_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217490773 NA 7.51E-07 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217490773 6.91E-06 5.30E-10 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217490773 NA 1.57E-06 mr1103_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217490773 NA 3.07E-08 mr1104_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217490773 9.01E-06 9.63E-08 mr1107_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217490773 1.38E-06 6.27E-11 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217490773 NA 9.45E-07 mr1408_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251