| Variant ID: vg1217386148 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 17386148 |
| Reference Allele: T | Alternative Allele: G,A,C |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ACCCTCCTAAGAAAAAAACCGTATCGATTTTAAAGAAGATGAATGGCCTAACATCATAAACGTTATTTAAAAAGCGGAATTTCATCCTTAGTGAGTTAAT[T/G,A,C]
ACGCTTAATCCTATTAGTTCAGAGCCCATATATAGATTAAAAGTCTACTAAACTTTCTACAAATGCTCTCAAACAGCCACGTGGCTCTCTTACAAACACT
AGTGTTTGTAAGAGAGCCACGTGGCTGTTTGAGAGCATTTGTAGAAAGTTTAGTAGACTTTTAATCTATATATGGGCTCTGAACTAATAGGATTAAGCGT[A/C,T,G]
ATTAACTCACTAAGGATGAAATTCCGCTTTTTAAATAACGTTTATGATGTTAGGCCATTCATCTTCTTTAAAATCGATACGGTTTTTTTCTTAGGAGGGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.30% | 12.10% | 7.91% | 11.64% | G: 6.16%; C: 1.80% |
| All Indica | 2759 | 53.10% | 9.40% | 8.84% | 15.77% | G: 10.08%; C: 2.83% |
| All Japonica | 1512 | 75.10% | 10.40% | 6.94% | 7.21% | G: 0.33% |
| Aus | 269 | 66.20% | 26.80% | 3.72% | 0.74% | C: 1.49%; G: 1.12% |
| Indica I | 595 | 76.60% | 1.70% | 5.71% | 13.95% | G: 1.34%; C: 0.67% |
| Indica II | 465 | 70.10% | 10.10% | 4.52% | 10.75% | G: 2.37%; C: 2.15% |
| Indica III | 913 | 28.00% | 14.60% | 11.06% | 18.07% | G: 23.22%; C: 5.04% |
| Indica Intermediate | 786 | 54.20% | 8.90% | 11.20% | 17.43% | G: 5.98%; C: 2.29% |
| Temperate Japonica | 767 | 78.00% | 1.00% | 11.73% | 9.26% | NA |
| Tropical Japonica | 504 | 67.70% | 26.80% | 0.60% | 4.37% | G: 0.60% |
| Japonica Intermediate | 241 | 81.30% | 6.20% | 4.98% | 6.64% | G: 0.83% |
| VI/Aromatic | 96 | 15.60% | 71.90% | 5.21% | 2.08% | G: 4.17%; C: 1.04% |
| Intermediate | 90 | 66.70% | 16.70% | 11.11% | 2.22% | C: 2.22%; G: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1217386148 | T -> A | LOC_Os12g29320-LOC_Os12g29330 | intergenic_region ; MODIFIER | silent_mutation | Average:31.571; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg1217386148 | T -> DEL | N | N | silent_mutation | Average:31.571; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg1217386148 | T -> G | LOC_Os12g29320-LOC_Os12g29330 | intergenic_region ; MODIFIER | silent_mutation | Average:31.571; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg1217386148 | T -> C | LOC_Os12g29320-LOC_Os12g29330 | intergenic_region ; MODIFIER | silent_mutation | Average:31.571; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1217386148 | NA | 2.29E-06 | mr1014 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217386148 | 2.10E-06 | 4.30E-09 | mr1004_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217386148 | 1.06E-06 | 1.47E-07 | mr1004_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217386148 | NA | 4.96E-06 | mr1011_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217386148 | NA | 1.78E-07 | mr1015_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217386148 | NA | 2.97E-06 | mr1705_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |