Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1217386148:

Variant ID: vg1217386148 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 17386148
Reference Allele: T	Alternative Allele: G,A,C
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACCCTCCTAAGAAAAAAACCGTATCGATTTTAAAGAAGATGAATGGCCTAACATCATAAACGTTATTTAAAAAGCGGAATTTCATCCTTAGTGAGTTAAT[T/G,A,C]
ACGCTTAATCCTATTAGTTCAGAGCCCATATATAGATTAAAAGTCTACTAAACTTTCTACAAATGCTCTCAAACAGCCACGTGGCTCTCTTACAAACACT

Reverse complement sequence

AGTGTTTGTAAGAGAGCCACGTGGCTGTTTGAGAGCATTTGTAGAAAGTTTAGTAGACTTTTAATCTATATATGGGCTCTGAACTAATAGGATTAAGCGT[A/C,T,G]
ATTAACTCACTAAGGATGAAATTCCGCTTTTTAAATAACGTTTATGATGTTAGGCCATTCATCTTCTTTAAAATCGATACGGTTTTTTTCTTAGGAGGGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.30%	12.10%	7.91%	11.64%	G: 6.16%; C: 1.80%
All Indica	2759	53.10%	9.40%	8.84%	15.77%	G: 10.08%; C: 2.83%
All Japonica	1512	75.10%	10.40%	6.94%	7.21%	G: 0.33%
Aus	269	66.20%	26.80%	3.72%	0.74%	C: 1.49%; G: 1.12%
Indica I	595	76.60%	1.70%	5.71%	13.95%	G: 1.34%; C: 0.67%
Indica II	465	70.10%	10.10%	4.52%	10.75%	G: 2.37%; C: 2.15%
Indica III	913	28.00%	14.60%	11.06%	18.07%	G: 23.22%; C: 5.04%
Indica Intermediate	786	54.20%	8.90%	11.20%	17.43%	G: 5.98%; C: 2.29%
Temperate Japonica	767	78.00%	1.00%	11.73%	9.26%	NA
Tropical Japonica	504	67.70%	26.80%	0.60%	4.37%	G: 0.60%
Japonica Intermediate	241	81.30%	6.20%	4.98%	6.64%	G: 0.83%
VI/Aromatic	96	15.60%	71.90%	5.21%	2.08%	G: 4.17%; C: 1.04%
Intermediate	90	66.70%	16.70%	11.11%	2.22%	C: 2.22%; G: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1217386148	T -> A	LOC_Os12g29320-LOC_Os12g29330	intergenic_region ; MODIFIER	silent_mutation	Average:31.571; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N
vg1217386148	T -> DEL	N	N	silent_mutation	Average:31.571; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N
vg1217386148	T -> G	LOC_Os12g29320-LOC_Os12g29330	intergenic_region ; MODIFIER	silent_mutation	Average:31.571; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N
vg1217386148	T -> C	LOC_Os12g29320-LOC_Os12g29330	intergenic_region ; MODIFIER	silent_mutation	Average:31.571; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1217386148	NA	2.29E-06	mr1014	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217386148	2.10E-06	4.30E-09	mr1004_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217386148	1.06E-06	1.47E-07	mr1004_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217386148	NA	4.96E-06	mr1011_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217386148	NA	1.78E-07	mr1015_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217386148	NA	2.97E-06	mr1705_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251