\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217370492:

Variant ID: vg1217370492 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17370492
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTCACAAGATCTCCGATCACAATGGACAGGTTTCCACTATTGTGCAACCTTAGGTGGGTATCAAGCCCATTTCCCTCGATGCACTATCTATCACATTAC[G/A]
TGGTAGCCCCTTGGTAAACTGATCTGCCAGATTTCTAGCCGTTTGGACATAGTCCAATGCTATCACTCCGGAGTTTTTCTGCTTTCTGACAGATTTCAGT

Reverse complement sequence

ACTGAAATCTGTCAGAAAGCAGAAAAACTCCGGAGTGATAGCATTGGACTATGTCCAAACGGCTAGAAATCTGGCAGATCAGTTTACCAAGGGGCTACCA[C/T]
GTAATGTGATAGATAGTGCATCGAGGGAAATGGGCTTGATACCCACCTAAGGTTGCACAATAGTGGAAACCTGTCCATTGTGATCGGAGATCTTGTGAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.80% 11.00% 2.60% 26.60% NA
All Indica  2759 61.80% 0.60% 3.59% 34.03% NA
All Japonica  1512 58.80% 31.00% 0.00% 10.25% NA
Aus  269 60.60% 7.80% 4.46% 27.14% NA
Indica I  595 86.20% 0.20% 0.67% 12.94% NA
Indica II  465 75.70% 0.40% 1.72% 22.15% NA
Indica III  913 38.30% 0.40% 7.67% 53.56% NA
Indica Intermediate  786 62.30% 1.10% 2.16% 34.35% NA
Temperate Japonica  767 93.20% 6.40% 0.00% 0.39% NA
Tropical Japonica  504 13.90% 59.30% 0.00% 26.79% NA
Japonica Intermediate  241 43.20% 49.80% 0.00% 7.05% NA
VI/Aromatic  96 20.80% 0.00% 10.42% 68.75% NA
Intermediate  90 54.40% 16.70% 2.22% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217370492 G -> DEL LOC_Os12g29310.1 N frameshift_variant Average:26.842; most accessible tissue: Zhenshan97 flower, score: 52.901 N N N N
vg1217370492 G -> A LOC_Os12g29310.1 missense_variant ; p.Arg1184Cys; MODERATE nonsynonymous_codon ; R1184C Average:26.842; most accessible tissue: Zhenshan97 flower, score: 52.901 benign 0.467 DELETERIOUS 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217370492 2.84E-09 2.77E-11 mr1388 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217370492 2.54E-07 6.61E-09 mr1388 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217370492 NA 1.34E-07 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217370492 NA 7.76E-08 mr1602 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217370492 NA 3.98E-06 mr1602 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217370492 NA 5.52E-06 mr1661 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217370492 NA 2.06E-06 mr1043_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217370492 NA 6.67E-06 mr1043_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217370492 NA 2.69E-09 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217370492 NA 2.46E-07 mr1269_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217370492 NA 1.60E-07 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217370492 NA 7.51E-09 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217370492 NA 1.27E-08 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217370492 NA 1.18E-06 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217370492 NA 3.96E-06 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217370492 7.56E-06 3.55E-13 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217370492 NA 1.46E-06 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251