\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217235620:

Variant ID: vg1217235620 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17235620
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.93, C: 0.06, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


TCCTCTATCTCCTCATCAAGATAATCTCTGATATCAAAGGAGAAAAGATCGGCTAAGACCTGCAGTAATGATTTGAAGAGGGTTAGAGATCAAACAGGCA[T/C]
AGCCGATCTGCATATGTTAGTTATAAGTAATTTACTGGAATAGCCGGAGCAATTGGTTGAACTTCTTCTTCTATGTGATGACTCCCTACAGCTGATGGGG

Reverse complement sequence

CCCCATCAGCTGTAGGGAGTCATCACATAGAAGAAGAAGTTCAACCAATTGCTCCGGCTATTCCAGTAAATTACTTATAACTAACATATGCAGATCGGCT[A/G]
TGCCTGTTTGATCTCTAACCCTCTTCAAATCATTACTGCAGGTCTTAGCCGATCTTTTCTCCTTTGATATCAGAGATTATCTTGATGAGGAGATAGAGGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.90% 28.70% 2.03% 9.42% NA
All Indica  2759 43.70% 40.40% 2.68% 13.19% NA
All Japonica  1512 81.00% 12.80% 1.19% 5.03% NA
Aus  269 92.60% 6.30% 0.37% 0.74% NA
Indica I  595 17.00% 78.00% 2.69% 2.35% NA
Indica II  465 31.40% 32.00% 2.80% 33.76% NA
Indica III  913 66.30% 23.80% 2.85% 7.12% NA
Indica Intermediate  786 45.00% 36.30% 2.42% 16.28% NA
Temperate Japonica  767 96.60% 0.80% 0.52% 2.09% NA
Tropical Japonica  504 59.50% 30.80% 1.19% 8.53% NA
Japonica Intermediate  241 75.90% 13.70% 3.32% 7.05% NA
VI/Aromatic  96 89.60% 9.40% 0.00% 1.04% NA
Intermediate  90 71.10% 23.30% 3.33% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217235620 T -> C LOC_Os12g29110.1 upstream_gene_variant ; 2470.0bp to feature; MODIFIER silent_mutation Average:45.554; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg1217235620 T -> C LOC_Os12g29100.1 downstream_gene_variant ; 3949.0bp to feature; MODIFIER silent_mutation Average:45.554; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg1217235620 T -> C LOC_Os12g29120.1 intron_variant ; MODIFIER silent_mutation Average:45.554; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg1217235620 T -> DEL N N silent_mutation Average:45.554; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217235620 NA 8.17E-06 mr1124 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217235620 NA 8.50E-06 mr1218 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217235620 NA 1.15E-06 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217235620 NA 2.34E-08 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217235620 NA 1.77E-08 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217235620 6.07E-06 NA mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217235620 9.77E-06 NA mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217235620 5.92E-06 NA mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217235620 1.19E-06 NA mr1145_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217235620 1.60E-06 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217235620 4.55E-06 NA mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217235620 NA 3.80E-06 mr1850_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217235620 8.22E-06 NA mr1986_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251