\
| Variant ID: vg1217235620 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 17235620 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.93, C: 0.06, others allele: 0.00, population size: 232. )
TCCTCTATCTCCTCATCAAGATAATCTCTGATATCAAAGGAGAAAAGATCGGCTAAGACCTGCAGTAATGATTTGAAGAGGGTTAGAGATCAAACAGGCA[T/C]
AGCCGATCTGCATATGTTAGTTATAAGTAATTTACTGGAATAGCCGGAGCAATTGGTTGAACTTCTTCTTCTATGTGATGACTCCCTACAGCTGATGGGG
CCCCATCAGCTGTAGGGAGTCATCACATAGAAGAAGAAGTTCAACCAATTGCTCCGGCTATTCCAGTAAATTACTTATAACTAACATATGCAGATCGGCT[A/G]
TGCCTGTTTGATCTCTAACCCTCTTCAAATCATTACTGCAGGTCTTAGCCGATCTTTTCTCCTTTGATATCAGAGATTATCTTGATGAGGAGATAGAGGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.90% | 28.70% | 2.03% | 9.42% | NA |
| All Indica | 2759 | 43.70% | 40.40% | 2.68% | 13.19% | NA |
| All Japonica | 1512 | 81.00% | 12.80% | 1.19% | 5.03% | NA |
| Aus | 269 | 92.60% | 6.30% | 0.37% | 0.74% | NA |
| Indica I | 595 | 17.00% | 78.00% | 2.69% | 2.35% | NA |
| Indica II | 465 | 31.40% | 32.00% | 2.80% | 33.76% | NA |
| Indica III | 913 | 66.30% | 23.80% | 2.85% | 7.12% | NA |
| Indica Intermediate | 786 | 45.00% | 36.30% | 2.42% | 16.28% | NA |
| Temperate Japonica | 767 | 96.60% | 0.80% | 0.52% | 2.09% | NA |
| Tropical Japonica | 504 | 59.50% | 30.80% | 1.19% | 8.53% | NA |
| Japonica Intermediate | 241 | 75.90% | 13.70% | 3.32% | 7.05% | NA |
| VI/Aromatic | 96 | 89.60% | 9.40% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 71.10% | 23.30% | 3.33% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1217235620 | T -> C | LOC_Os12g29110.1 | upstream_gene_variant ; 2470.0bp to feature; MODIFIER | silent_mutation | Average:45.554; most accessible tissue: Minghui63 young leaf, score: 61.007 | N | N | N | N |
| vg1217235620 | T -> C | LOC_Os12g29100.1 | downstream_gene_variant ; 3949.0bp to feature; MODIFIER | silent_mutation | Average:45.554; most accessible tissue: Minghui63 young leaf, score: 61.007 | N | N | N | N |
| vg1217235620 | T -> C | LOC_Os12g29120.1 | intron_variant ; MODIFIER | silent_mutation | Average:45.554; most accessible tissue: Minghui63 young leaf, score: 61.007 | N | N | N | N |
| vg1217235620 | T -> DEL | N | N | silent_mutation | Average:45.554; most accessible tissue: Minghui63 young leaf, score: 61.007 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1217235620 | NA | 8.17E-06 | mr1124 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217235620 | NA | 8.50E-06 | mr1218 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217235620 | NA | 1.15E-06 | mr1422 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217235620 | NA | 2.34E-08 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217235620 | NA | 1.77E-08 | mr1707 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217235620 | 6.07E-06 | NA | mr1083_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217235620 | 9.77E-06 | NA | mr1083_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217235620 | 5.92E-06 | NA | mr1132_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217235620 | 1.19E-06 | NA | mr1145_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217235620 | 1.60E-06 | NA | mr1226_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217235620 | 4.55E-06 | NA | mr1226_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217235620 | NA | 3.80E-06 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217235620 | 8.22E-06 | NA | mr1986_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |