\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217221999:

Variant ID: vg1217221999 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17221999
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.85, A: 0.16, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


TATTGTTATATCGCCCTTAGTTGTTTCATATTTTTATCAATGCTCTTGACATTATAAAACTAGGGGGACATATATATATCTCACAATACAGTGCAAAAAA[T/A]
TTTTTTTCGCTGATTACAAAATTATTGGGACAAGTATTGCTGGATAGCCGATATGGCTCTCTGCCTAATTTGTTCTACTTCTTCTATGGCTTAGGCATCT

Reverse complement sequence

AGATGCCTAAGCCATAGAAGAAGTAGAACAAATTAGGCAGAGAGCCATATCGGCTATCCAGCAATACTTGTCCCAATAATTTTGTAATCAGCGAAAAAAA[A/T]
TTTTTTGCACTGTATTGTGAGATATATATATGTCCCCCTAGTTTTATAATGTCAAGAGCATTGATAAAAATATGAAACAACTAAGGGCGATATAACAATA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.70% 14.30% 0.63% 10.37% NA
All Indica  2759 68.00% 16.90% 0.62% 14.53% NA
All Japonica  1512 80.60% 13.00% 0.86% 5.56% NA
Aus  269 98.50% 0.70% 0.00% 0.74% NA
Indica I  595 90.10% 5.70% 0.00% 4.20% NA
Indica II  465 33.80% 30.10% 1.29% 34.84% NA
Indica III  913 74.70% 15.90% 0.44% 8.98% NA
Indica Intermediate  786 63.70% 18.60% 0.89% 16.79% NA
Temperate Japonica  767 94.80% 1.70% 1.17% 2.35% NA
Tropical Japonica  504 60.30% 30.40% 0.79% 8.53% NA
Japonica Intermediate  241 77.60% 12.90% 0.00% 9.54% NA
VI/Aromatic  96 97.90% 1.00% 0.00% 1.04% NA
Intermediate  90 84.40% 13.30% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217221999 T -> DEL N N silent_mutation Average:31.837; most accessible tissue: Minghui63 flag leaf, score: 46.761 N N N N
vg1217221999 T -> A LOC_Os12g29090.1 upstream_gene_variant ; 3515.0bp to feature; MODIFIER silent_mutation Average:31.837; most accessible tissue: Minghui63 flag leaf, score: 46.761 N N N N
vg1217221999 T -> A LOC_Os12g29070.1 downstream_gene_variant ; 485.0bp to feature; MODIFIER silent_mutation Average:31.837; most accessible tissue: Minghui63 flag leaf, score: 46.761 N N N N
vg1217221999 T -> A LOC_Os12g29080.1 downstream_gene_variant ; 988.0bp to feature; MODIFIER silent_mutation Average:31.837; most accessible tissue: Minghui63 flag leaf, score: 46.761 N N N N
vg1217221999 T -> A LOC_Os12g29070-LOC_Os12g29080 intergenic_region ; MODIFIER silent_mutation Average:31.837; most accessible tissue: Minghui63 flag leaf, score: 46.761 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217221999 NA 5.29E-07 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217221999 1.27E-06 NA mr1022_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217221999 4.54E-07 NA mr1023_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217221999 4.56E-07 NA mr1055_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217221999 2.52E-06 NA mr1079_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217221999 9.07E-08 NA mr1132_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217221999 7.13E-06 NA mr1390_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217221999 8.54E-06 NA mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217221999 1.74E-06 NA mr1490_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251