Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1217221999:

Variant ID: vg1217221999 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 17221999
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.85, A: 0.16, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

TATTGTTATATCGCCCTTAGTTGTTTCATATTTTTATCAATGCTCTTGACATTATAAAACTAGGGGGACATATATATATCTCACAATACAGTGCAAAAAA[T/A]
TTTTTTTCGCTGATTACAAAATTATTGGGACAAGTATTGCTGGATAGCCGATATGGCTCTCTGCCTAATTTGTTCTACTTCTTCTATGGCTTAGGCATCT

Reverse complement sequence

AGATGCCTAAGCCATAGAAGAAGTAGAACAAATTAGGCAGAGAGCCATATCGGCTATCCAGCAATACTTGTCCCAATAATTTTGTAATCAGCGAAAAAAA[A/T]
TTTTTTGCACTGTATTGTGAGATATATATATGTCCCCCTAGTTTTATAATGTCAAGAGCATTGATAAAAATATGAAACAACTAAGGGCGATATAACAATA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.70%	14.30%	0.63%	10.37%	NA
All Indica	2759	68.00%	16.90%	0.62%	14.53%	NA
All Japonica	1512	80.60%	13.00%	0.86%	5.56%	NA
Aus	269	98.50%	0.70%	0.00%	0.74%	NA
Indica I	595	90.10%	5.70%	0.00%	4.20%	NA
Indica II	465	33.80%	30.10%	1.29%	34.84%	NA
Indica III	913	74.70%	15.90%	0.44%	8.98%	NA
Indica Intermediate	786	63.70%	18.60%	0.89%	16.79%	NA
Temperate Japonica	767	94.80%	1.70%	1.17%	2.35%	NA
Tropical Japonica	504	60.30%	30.40%	0.79%	8.53%	NA
Japonica Intermediate	241	77.60%	12.90%	0.00%	9.54%	NA
VI/Aromatic	96	97.90%	1.00%	0.00%	1.04%	NA
Intermediate	90	84.40%	13.30%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1217221999	T -> DEL	N	N	silent_mutation	Average:31.837; most accessible tissue: Minghui63 flag leaf, score: 46.761	N	N	N	N
vg1217221999	T -> A	LOC_Os12g29090.1	upstream_gene_variant ; 3515.0bp to feature; MODIFIER	silent_mutation	Average:31.837; most accessible tissue: Minghui63 flag leaf, score: 46.761	N	N	N	N
vg1217221999	T -> A	LOC_Os12g29070.1	downstream_gene_variant ; 485.0bp to feature; MODIFIER	silent_mutation	Average:31.837; most accessible tissue: Minghui63 flag leaf, score: 46.761	N	N	N	N
vg1217221999	T -> A	LOC_Os12g29080.1	downstream_gene_variant ; 988.0bp to feature; MODIFIER	silent_mutation	Average:31.837; most accessible tissue: Minghui63 flag leaf, score: 46.761	N	N	N	N
vg1217221999	T -> A	LOC_Os12g29070-LOC_Os12g29080	intergenic_region ; MODIFIER	silent_mutation	Average:31.837; most accessible tissue: Minghui63 flag leaf, score: 46.761	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1217221999	NA	5.29E-07	mr1583	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217221999	1.27E-06	NA	mr1022_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217221999	4.54E-07	NA	mr1023_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217221999	4.56E-07	NA	mr1055_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217221999	2.52E-06	NA	mr1079_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217221999	9.07E-08	NA	mr1132_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217221999	7.13E-06	NA	mr1390_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217221999	8.54E-06	NA	mr1489_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217221999	1.74E-06	NA	mr1490_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251