| Variant ID: vg1217221999 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 17221999 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.85, A: 0.16, others allele: 0.00, population size: 86. )
TATTGTTATATCGCCCTTAGTTGTTTCATATTTTTATCAATGCTCTTGACATTATAAAACTAGGGGGACATATATATATCTCACAATACAGTGCAAAAAA[T/A]
TTTTTTTCGCTGATTACAAAATTATTGGGACAAGTATTGCTGGATAGCCGATATGGCTCTCTGCCTAATTTGTTCTACTTCTTCTATGGCTTAGGCATCT
AGATGCCTAAGCCATAGAAGAAGTAGAACAAATTAGGCAGAGAGCCATATCGGCTATCCAGCAATACTTGTCCCAATAATTTTGTAATCAGCGAAAAAAA[A/T]
TTTTTTGCACTGTATTGTGAGATATATATATGTCCCCCTAGTTTTATAATGTCAAGAGCATTGATAAAAATATGAAACAACTAAGGGCGATATAACAATA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.70% | 14.30% | 0.63% | 10.37% | NA |
| All Indica | 2759 | 68.00% | 16.90% | 0.62% | 14.53% | NA |
| All Japonica | 1512 | 80.60% | 13.00% | 0.86% | 5.56% | NA |
| Aus | 269 | 98.50% | 0.70% | 0.00% | 0.74% | NA |
| Indica I | 595 | 90.10% | 5.70% | 0.00% | 4.20% | NA |
| Indica II | 465 | 33.80% | 30.10% | 1.29% | 34.84% | NA |
| Indica III | 913 | 74.70% | 15.90% | 0.44% | 8.98% | NA |
| Indica Intermediate | 786 | 63.70% | 18.60% | 0.89% | 16.79% | NA |
| Temperate Japonica | 767 | 94.80% | 1.70% | 1.17% | 2.35% | NA |
| Tropical Japonica | 504 | 60.30% | 30.40% | 0.79% | 8.53% | NA |
| Japonica Intermediate | 241 | 77.60% | 12.90% | 0.00% | 9.54% | NA |
| VI/Aromatic | 96 | 97.90% | 1.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 84.40% | 13.30% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1217221999 | T -> DEL | N | N | silent_mutation | Average:31.837; most accessible tissue: Minghui63 flag leaf, score: 46.761 | N | N | N | N |
| vg1217221999 | T -> A | LOC_Os12g29090.1 | upstream_gene_variant ; 3515.0bp to feature; MODIFIER | silent_mutation | Average:31.837; most accessible tissue: Minghui63 flag leaf, score: 46.761 | N | N | N | N |
| vg1217221999 | T -> A | LOC_Os12g29070.1 | downstream_gene_variant ; 485.0bp to feature; MODIFIER | silent_mutation | Average:31.837; most accessible tissue: Minghui63 flag leaf, score: 46.761 | N | N | N | N |
| vg1217221999 | T -> A | LOC_Os12g29080.1 | downstream_gene_variant ; 988.0bp to feature; MODIFIER | silent_mutation | Average:31.837; most accessible tissue: Minghui63 flag leaf, score: 46.761 | N | N | N | N |
| vg1217221999 | T -> A | LOC_Os12g29070-LOC_Os12g29080 | intergenic_region ; MODIFIER | silent_mutation | Average:31.837; most accessible tissue: Minghui63 flag leaf, score: 46.761 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1217221999 | NA | 5.29E-07 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217221999 | 1.27E-06 | NA | mr1022_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217221999 | 4.54E-07 | NA | mr1023_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217221999 | 4.56E-07 | NA | mr1055_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217221999 | 2.52E-06 | NA | mr1079_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217221999 | 9.07E-08 | NA | mr1132_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217221999 | 7.13E-06 | NA | mr1390_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217221999 | 8.54E-06 | NA | mr1489_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217221999 | 1.74E-06 | NA | mr1490_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |