\
| Variant ID: vg1217216616 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 17216616 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 263. )
TCTGATCTTACGTCAATCAAGCAAAAGCATGATGAGCCAGTGCAAGAGTATATTCAAAGGTTCAGGGAAATGAGGAATAAATGTTACAGCTTGAGTTTGA[C/T]
CGATGCCCAGCTAGCCGATTTGGCGTTTCAAGGGATGATTGCTCCGATCAGGGAAAAATTCTCATATGAAGATTTCGAAAGTTTGTCGCATCTTACACAG
CTGTGTAAGATGCGACAAACTTTCGAAATCTTCATATGAGAATTTTTCCCTGATCGGAGCAATCATCCCTTGAAACGCCAAATCGGCTAGCTGGGCATCG[G/A]
TCAAACTCAAGCTGTAACATTTATTCCTCATTTCCCTGAACCTTTGAATATACTCTTGCACTGGCTCATCATGCTTTTGCTTGATTGACGTAAGATCAGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.60% | 22.70% | 3.17% | 4.53% | NA |
| All Indica | 2759 | 58.50% | 30.40% | 3.91% | 7.21% | NA |
| All Japonica | 1512 | 83.90% | 12.70% | 2.58% | 0.86% | NA |
| Aus | 269 | 94.10% | 4.50% | 0.74% | 0.74% | NA |
| Indica I | 595 | 22.70% | 57.60% | 6.39% | 13.28% | NA |
| Indica II | 465 | 65.60% | 26.00% | 3.87% | 4.52% | NA |
| Indica III | 913 | 75.00% | 19.10% | 1.53% | 4.38% | NA |
| Indica Intermediate | 786 | 62.10% | 25.60% | 4.83% | 7.51% | NA |
| Temperate Japonica | 767 | 97.50% | 0.70% | 0.52% | 1.30% | NA |
| Tropical Japonica | 504 | 63.70% | 30.60% | 5.75% | 0.00% | NA |
| Japonica Intermediate | 241 | 82.60% | 13.70% | 2.49% | 1.24% | NA |
| VI/Aromatic | 96 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 23.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1217216616 | C -> DEL | LOC_Os12g29070.1 | N | frameshift_variant | Average:37.464; most accessible tissue: Minghui63 flag leaf, score: 59.912 | N | N | N | N |
| vg1217216616 | C -> T | LOC_Os12g29070.1 | missense_variant ; p.Thr583Ile; MODERATE | nonsynonymous_codon ; T583I | Average:37.464; most accessible tissue: Minghui63 flag leaf, score: 59.912 | benign |
0.738 |
DELETERIOUS | 0.02 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1217216616 | NA | 8.17E-06 | mr1124 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217216616 | NA | 8.50E-06 | mr1218 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217216616 | 3.84E-06 | NA | mr1422 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217216616 | NA | 1.15E-06 | mr1422 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217216616 | NA | 8.51E-06 | mr1511 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217216616 | NA | 2.34E-08 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217216616 | NA | 5.48E-09 | mr1707 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217216616 | 9.77E-06 | NA | mr1083_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217216616 | 5.98E-06 | NA | mr1132_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217216616 | 5.92E-06 | NA | mr1132_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217216616 | 4.55E-06 | NA | mr1226_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217216616 | NA | 3.87E-06 | mr1659_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217216616 | NA | 3.80E-06 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217216616 | 4.21E-06 | 9.92E-06 | mr1986_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |