Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1217198502:

Variant ID: vg1217198502 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 17198502
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 327. )

Flanking Sequence (100 bp) in Reference Genome:

ATGCGGGCGTGCCTATCAGTTTGATCATGCAACTGACAAGATATAGAAATAGTAGATTAATGAGCCGATCGGCTGGCAAGCCGATGAAGTAAGTCCAGCC[G/A]
ATGCCGATACTAGACGATAGTGAAAGGATTTTGAGCTATCGGCTATATGATTGATGTAGAATCTGACACTTGATGTAAATAGAGACAATCGACTGATGAT

Reverse complement sequence

ATCATCAGTCGATTGTCTCTATTTACATCAAGTGTCAGATTCTACATCAATCATATAGCCGATAGCTCAAAATCCTTTCACTATCGTCTAGTATCGGCAT[C/T]
GGCTGGACTTACTTCATCGGCTTGCCAGCCGATCGGCTCATTAATCTACTATTTCTATATCTTGTCAGTTGCATGATCAAACTGATAGGCACGCCCGCAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.30%	7.50%	0.23%	0.00%	NA
All Indica	2759	99.60%	0.30%	0.04%	0.00%	NA
All Japonica	1512	78.40%	20.90%	0.66%	0.00%	NA
Aus	269	92.20%	7.80%	0.00%	0.00%	NA
Indica I	595	99.70%	0.20%	0.17%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.20%	0.80%	0.00%	0.00%	NA
Temperate Japonica	767	88.00%	11.00%	1.04%	0.00%	NA
Tropical Japonica	504	72.60%	27.40%	0.00%	0.00%	NA
Japonica Intermediate	241	60.20%	39.00%	0.83%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	7.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1217198502	G -> A	LOC_Os12g29040.1	upstream_gene_variant ; 1222.0bp to feature; MODIFIER	silent_mutation	Average:48.797; most accessible tissue: Zhenshan97 young leaf, score: 70.625	N	N	N	N
vg1217198502	G -> A	LOC_Os12g29050.1	upstream_gene_variant ; 1508.0bp to feature; MODIFIER	silent_mutation	Average:48.797; most accessible tissue: Zhenshan97 young leaf, score: 70.625	N	N	N	N
vg1217198502	G -> A	LOC_Os12g29040-LOC_Os12g29050	intergenic_region ; MODIFIER	silent_mutation	Average:48.797; most accessible tissue: Zhenshan97 young leaf, score: 70.625	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1217198502	NA	7.16E-08	mr1280	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198502	NA	6.40E-08	mr1280	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198502	NA	8.65E-06	mr1729	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198502	NA	7.49E-06	mr1788	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198502	NA	5.74E-07	mr1788	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198502	NA	9.09E-07	mr1807	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198502	NA	1.43E-08	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198502	NA	1.17E-07	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198502	NA	1.65E-07	mr1318_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198502	NA	4.88E-08	mr1318_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198502	NA	1.44E-07	mr1521_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198502	NA	5.42E-07	mr1702_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198502	NA	4.56E-07	mr1702_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198502	NA	2.49E-06	mr1729_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198502	NA	5.08E-06	mr1741_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198502	NA	5.59E-07	mr1788_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198502	NA	1.21E-08	mr1788_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217198502	NA	3.71E-06	mr1865_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251