\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217179765:

Variant ID: vg1217179765 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17179765
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAACAGTATTACATACGTATAGTATCCATCTAGAAGTCATAATCATGAAATAATCACGGATATCCAAACAAACAACCTGAAACCGAAACTGACACAAAGT[T/C]
AGCCGGTCAGACCGCGGGCTGCGTCGGTCCGACCGCTTGATCACCGCTGGTCTGTCCGGCATACACAGCCCGGTCTGACCGGTCACATAAAATGATAGAA

Reverse complement sequence

TTCTATCATTTTATGTGACCGGTCAGACCGGGCTGTGTATGCCGGACAGACCAGCGGTGATCAAGCGGTCGGACCGACGCAGCCCGCGGTCTGACCGGCT[A/G]
ACTTTGTGTCAGTTTCGGTTTCAGGTTGTTTGTTTGGATATCCGTGATTATTTCATGATTATGACTTCTAGATGGATACTATACGTATGTAATACTGTTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.20% 6.90% 0.21% 2.73% NA
All Indica  2759 97.00% 1.40% 0.14% 1.38% NA
All Japonica  1512 93.70% 0.20% 0.33% 5.82% NA
Aus  269 19.00% 80.70% 0.37% 0.00% NA
Indica I  595 97.00% 0.00% 0.17% 2.86% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 96.60% 1.30% 0.33% 1.75% NA
Indica Intermediate  786 96.20% 3.20% 0.00% 0.64% NA
Temperate Japonica  767 97.70% 0.00% 0.26% 2.09% NA
Tropical Japonica  504 90.10% 0.00% 0.40% 9.52% NA
Japonica Intermediate  241 88.40% 1.20% 0.41% 9.96% NA
VI/Aromatic  96 41.70% 58.30% 0.00% 0.00% NA
Intermediate  90 87.80% 8.90% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217179765 T -> C LOC_Os12g29020.1 downstream_gene_variant ; 4052.0bp to feature; MODIFIER silent_mutation Average:45.144; most accessible tissue: Minghui63 flag leaf, score: 72.907 N N N N
vg1217179765 T -> C LOC_Os12g29020-LOC_Os12g29030 intergenic_region ; MODIFIER silent_mutation Average:45.144; most accessible tissue: Minghui63 flag leaf, score: 72.907 N N N N
vg1217179765 T -> DEL N N silent_mutation Average:45.144; most accessible tissue: Minghui63 flag leaf, score: 72.907 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217179765 NA 1.58E-12 mr1231 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217179765 NA 5.08E-08 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217179765 NA 2.11E-16 mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217179765 NA 3.61E-07 mr1803 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217179765 NA 9.85E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217179765 NA 2.55E-23 mr1120_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217179765 NA 2.64E-07 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217179765 NA 3.56E-06 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217179765 NA 6.02E-13 mr1166_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217179765 NA 1.57E-22 mr1247_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217179765 NA 1.98E-23 mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217179765 NA 5.26E-06 mr1522_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217179765 NA 2.13E-08 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217179765 NA 1.97E-08 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217179765 NA 7.45E-27 mr1757_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217179765 NA 2.78E-08 mr1762_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217179765 NA 3.38E-08 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217179765 NA 2.18E-12 mr1803_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217179765 NA 1.23E-17 mr1911_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217179765 NA 1.42E-11 mr1918_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217179765 NA 6.88E-08 mr1929_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217179765 NA 2.21E-17 mr1961_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251