\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217175447:

Variant ID: vg1217175447 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17175447
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.72, G: 0.28, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


TGGGATGTCTGGCAAGTTAGCACCCCGCTACATCGGCCCCTACCTCACAACCGCCAGACGTGGCGAAGTGGCTTATCAGTTTGAGTTACCTGAAGGTCTC[A/G]
CAGATGTGCACAACGTGTTCCACGTATCCCAGTTAAAGAAATGTCTTTGAGTTCCAGAAGAACAAGTTCCCCTGGGTAATATCGAGCTAGAAAAGAATCT

Reverse complement sequence

AGATTCTTTTCTAGCTCGATATTACCCAGGGGAACTTGTTCTTCTGGAACTCAAAGACATTTCTTTAACTGGGATACGTGGAACACGTTGTGCACATCTG[T/C]
GAGACCTTCAGGTAACTCAAACTGATAAGCCACTTCGCCACGTCTGGCGGTTGTGAGGTAGGGGCCGATGTAGCGGGGTGCTAACTTGCCAGACATCCCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 26.90% 20.90% 27.51% 24.69% NA
All Indica  2759 5.70% 30.70% 34.90% 28.63% NA
All Japonica  1512 69.70% 6.50% 17.06% 6.75% NA
Aus  269 9.30% 5.20% 6.32% 79.18% NA
Indica I  595 4.20% 19.00% 36.97% 39.83% NA
Indica II  465 3.70% 17.20% 45.59% 33.55% NA
Indica III  913 5.90% 51.60% 24.53% 17.96% NA
Indica Intermediate  786 7.90% 23.40% 39.06% 29.64% NA
Temperate Japonica  767 96.20% 0.40% 1.17% 2.22% NA
Tropical Japonica  504 30.40% 16.10% 42.46% 11.11% NA
Japonica Intermediate  241 67.60% 5.80% 14.52% 12.03% NA
VI/Aromatic  96 2.10% 11.50% 35.42% 51.04% NA
Intermediate  90 35.60% 18.90% 31.11% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217175447 A -> DEL N N silent_mutation Average:20.867; most accessible tissue: Callus, score: 41.735 N N N N
vg1217175447 A -> G LOC_Os12g29020.1 intron_variant ; MODIFIER silent_mutation Average:20.867; most accessible tissue: Callus, score: 41.735 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217175447 NA 2.58E-09 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175447 8.67E-06 NA mr1293 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175447 NA 5.36E-06 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175447 NA 2.64E-07 mr1334 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175447 NA 4.37E-06 mr1382 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175447 NA 1.18E-18 mr1401 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175447 NA 7.90E-06 mr1414 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175447 NA 2.72E-22 mr1422 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175447 NA 2.82E-06 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175447 NA 2.45E-06 mr1450 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175447 4.87E-06 NA mr1485 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175447 NA 2.61E-06 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175447 NA 1.25E-07 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175447 NA 9.46E-08 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175447 3.38E-06 NA mr1774 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175447 8.70E-06 NA mr1820 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175447 NA 2.78E-07 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175447 NA 1.39E-06 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175447 NA 1.05E-09 mr1089_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175447 NA 1.19E-07 mr1257_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175447 NA 2.61E-06 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175447 NA 1.12E-16 mr1457_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217175447 NA 8.27E-07 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251