\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217056602:

Variant ID: vg1217056602 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17056602
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTGAAGTGGTGAGAATGTTAGGGCTTAAGGAGCGAGAAGACGAGTGGGCAGTTGGCGAAAGGAAGGAGACAACATCCTTGCCTCCGTATCCTTTTATCCT[C/T]
GCCTCACCCACGCTCACCTCCTCGTTTCACGCCCTCACGGTTGCCCCCACGATTCTCGCGCCCACGGTTGTCTCTTCGTTTCCCGCGTCAACTCATCACG

Reverse complement sequence

CGTGATGAGTTGACGCGGGAAACGAAGAGACAACCGTGGGCGCGAGAATCGTGGGGGCAACCGTGAGGGCGTGAAACGAGGAGGTGAGCGTGGGTGAGGC[G/A]
AGGATAAAAGGATACGGAGGCAAGGATGTTGTCTCCTTCCTTTCGCCAACTGCCCACTCGTCTTCTCGCTCCTTAAGCCCTAACATTCTCACCACTTCAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.60% 15.20% 0.59% 0.61% NA
All Indica  2759 74.70% 25.20% 0.04% 0.04% NA
All Japonica  1512 97.60% 0.30% 0.20% 1.85% NA
Aus  269 97.80% 0.70% 1.49% 0.00% NA
Indica I  595 87.40% 12.60% 0.00% 0.00% NA
Indica II  465 96.60% 3.40% 0.00% 0.00% NA
Indica III  913 51.30% 48.70% 0.00% 0.00% NA
Indica Intermediate  786 79.40% 20.40% 0.13% 0.13% NA
Temperate Japonica  767 98.00% 0.30% 0.00% 1.69% NA
Tropical Japonica  504 98.20% 0.60% 0.00% 1.19% NA
Japonica Intermediate  241 95.00% 0.00% 1.24% 3.73% NA
VI/Aromatic  96 76.00% 4.20% 19.79% 0.00% NA
Intermediate  90 84.40% 14.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217056602 C -> DEL N N silent_mutation Average:53.996; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 N N N N
vg1217056602 C -> T LOC_Os12g28850.1 upstream_gene_variant ; 146.0bp to feature; MODIFIER silent_mutation Average:53.996; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 N N N N
vg1217056602 C -> T LOC_Os12g28850-LOC_Os12g28860 intergenic_region ; MODIFIER silent_mutation Average:53.996; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217056602 NA 8.49E-06 mr1305 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217056602 1.32E-06 NA mr1051_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217056602 4.35E-06 6.02E-07 mr1051_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217056602 NA 3.31E-06 mr1092_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251