\
| Variant ID: vg1217056602 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 17056602 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GTGAAGTGGTGAGAATGTTAGGGCTTAAGGAGCGAGAAGACGAGTGGGCAGTTGGCGAAAGGAAGGAGACAACATCCTTGCCTCCGTATCCTTTTATCCT[C/T]
GCCTCACCCACGCTCACCTCCTCGTTTCACGCCCTCACGGTTGCCCCCACGATTCTCGCGCCCACGGTTGTCTCTTCGTTTCCCGCGTCAACTCATCACG
CGTGATGAGTTGACGCGGGAAACGAAGAGACAACCGTGGGCGCGAGAATCGTGGGGGCAACCGTGAGGGCGTGAAACGAGGAGGTGAGCGTGGGTGAGGC[G/A]
AGGATAAAAGGATACGGAGGCAAGGATGTTGTCTCCTTCCTTTCGCCAACTGCCCACTCGTCTTCTCGCTCCTTAAGCCCTAACATTCTCACCACTTCAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.60% | 15.20% | 0.59% | 0.61% | NA |
| All Indica | 2759 | 74.70% | 25.20% | 0.04% | 0.04% | NA |
| All Japonica | 1512 | 97.60% | 0.30% | 0.20% | 1.85% | NA |
| Aus | 269 | 97.80% | 0.70% | 1.49% | 0.00% | NA |
| Indica I | 595 | 87.40% | 12.60% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.60% | 3.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 51.30% | 48.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 79.40% | 20.40% | 0.13% | 0.13% | NA |
| Temperate Japonica | 767 | 98.00% | 0.30% | 0.00% | 1.69% | NA |
| Tropical Japonica | 504 | 98.20% | 0.60% | 0.00% | 1.19% | NA |
| Japonica Intermediate | 241 | 95.00% | 0.00% | 1.24% | 3.73% | NA |
| VI/Aromatic | 96 | 76.00% | 4.20% | 19.79% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 14.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1217056602 | C -> DEL | N | N | silent_mutation | Average:53.996; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 | N | N | N | N |
| vg1217056602 | C -> T | LOC_Os12g28850.1 | upstream_gene_variant ; 146.0bp to feature; MODIFIER | silent_mutation | Average:53.996; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 | N | N | N | N |
| vg1217056602 | C -> T | LOC_Os12g28850-LOC_Os12g28860 | intergenic_region ; MODIFIER | silent_mutation | Average:53.996; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1217056602 | NA | 8.49E-06 | mr1305 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217056602 | 1.32E-06 | NA | mr1051_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217056602 | 4.35E-06 | 6.02E-07 | mr1051_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217056602 | NA | 3.31E-06 | mr1092_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |