Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1217045770:

Variant ID: vg1217045770 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17045770
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


TCAGGGAACCGTCGCCACGCTCGACGGGGGGGGGGGGGGGGGGCGTGCGCTCACACCTCTCGCCGGGGCTTCAAGGCCATGAGGCGAGAGCTTTTGGCCG[C/T]
TGTTCCCACGCACGAGGCGGCTCGGAAGGCGCGCTGGTCGGAGGTGAAGCTCACCTTTGACCAGAGCGACCATCCGACAGTGCTCGCTCGAGGAGGGAAG

Reverse complement sequence

CTTCCCTCCTCGAGCGAGCACTGTCGGATGGTCGCTCTGGTCAAAGGTGAGCTTCACCTCCGACCAGCGCGCCTTCCGAGCCGCCTCGTGCGTGGGAACA[G/A]
CGGCCAAAAGCTCTCGCCTCATGGCCTTGAAGCCCCGGCGAGAGGTGTGAGCGCACGCCCCCCCCCCCCCCCCCCGTCGAGCGTGGCGACGGTTCCCTGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.60% 7.30% 1.08% 0.99% NA
All Indica  2759 97.70% 2.20% 0.07% 0.04% NA
All Japonica  1512 79.00% 16.50% 1.52% 2.98% NA
Aus  269 99.30% 0.40% 0.37% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 90.50% 9.50% 0.00% 0.00% NA
Indica III  913 99.30% 0.50% 0.11% 0.00% NA
Indica Intermediate  786 98.30% 1.40% 0.13% 0.13% NA
Temperate Japonica  767 96.70% 1.20% 0.39% 1.69% NA
Tropical Japonica  504 50.20% 42.70% 2.78% 4.37% NA
Japonica Intermediate  241 82.60% 10.80% 2.49% 4.15% NA
VI/Aromatic  96 51.00% 25.00% 23.96% 0.00% NA
Intermediate  90 84.40% 12.20% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217045770 C -> DEL LOC_Os12g28830.1 N frameshift_variant Average:70.145; most accessible tissue: Minghui63 flag leaf, score: 91.692 N N N N
vg1217045770 C -> T LOC_Os12g28830.1 missense_variant ; p.Ala311Val; MODERATE nonsynonymous_codon ; A311V Average:70.145; most accessible tissue: Minghui63 flag leaf, score: 91.692 benign 1.164 TOLERATED 0.08

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1217045770 C T -0.01 -0.02 -0.01 -0.02 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217045770 9.60E-06 NA mr1076 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217045770 NA 8.75E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217045770 1.97E-09 NA mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217045770 NA 4.13E-09 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217045770 1.86E-07 NA mr1085 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217045770 4.96E-06 NA mr1103 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217045770 4.56E-07 NA mr1204 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217045770 1.31E-06 NA mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217045770 NA 9.64E-07 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217045770 NA 5.82E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217045770 NA 1.52E-08 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217045770 5.10E-06 NA mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217045770 NA 1.16E-06 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217045770 4.80E-06 NA mr1560 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217045770 6.96E-06 6.96E-06 mr1076_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217045770 8.47E-08 NA mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217045770 NA 1.67E-07 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217045770 9.26E-08 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217045770 NA 6.43E-06 mr1104_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217045770 1.83E-06 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217045770 7.49E-08 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217045770 NA 1.40E-07 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217045770 NA 1.24E-08 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217045770 NA 1.64E-09 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217045770 NA 8.45E-06 mr1408_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251