\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216930362:

Variant ID: vg1216930362 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16930362
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.59, A: 0.41, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:


GTTCGCGGGATGCCCTAGAAGAACTTATCGTACTTACCACAAGCCAGCGTGGGCAACGGCTGGGCTTGTAGTATAGCTTTTCTCTAGCTGACGCATCCAG[A/G]
CAAGGGTGGGCGTGATGGAGTTTGGATGGGCCCTGCGACGGCCTATACGGCTTCCGGATTCACCTAGGCACGAGAGGGGACTGCCCGTCGCCCGCTGGGG

Reverse complement sequence

CCCCAGCGGGCGACGGGCAGTCCCCTCTCGTGCCTAGGTGAATCCGGAAGCCGTATAGGCCGTCGCAGGGCCCATCCAAACTCCATCACGCCCACCCTTG[T/C]
CTGGATGCGTCAGCTAGAGAAAAGCTATACTACAAGCCCAGCCGTTGCCCACGCTGGCTTGTGGTAAGTACGATAAGTTCTTCTAGGGCATCCCGCGAAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.00% 6.70% 39.00% 22.34% NA
All Indica  2759 12.20% 8.80% 56.36% 22.69% NA
All Japonica  1512 71.80% 3.00% 4.63% 20.57% NA
Aus  269 15.20% 5.90% 47.21% 31.60% NA
Indica I  595 26.40% 8.40% 36.47% 28.74% NA
Indica II  465 8.00% 4.30% 62.15% 25.59% NA
Indica III  913 2.60% 12.80% 67.47% 17.09% NA
Indica Intermediate  786 15.00% 7.00% 55.09% 22.90% NA
Temperate Japonica  767 94.00% 0.10% 1.69% 4.17% NA
Tropical Japonica  504 34.90% 8.50% 7.94% 48.61% NA
Japonica Intermediate  241 78.40% 0.40% 7.05% 14.11% NA
VI/Aromatic  96 4.20% 11.50% 63.54% 20.83% NA
Intermediate  90 47.80% 3.30% 33.33% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216930362 A -> DEL N N silent_mutation Average:21.58; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg1216930362 A -> G LOC_Os12g28630.1 upstream_gene_variant ; 1303.0bp to feature; MODIFIER silent_mutation Average:21.58; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg1216930362 A -> G LOC_Os12g28620.1 downstream_gene_variant ; 3410.0bp to feature; MODIFIER silent_mutation Average:21.58; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg1216930362 A -> G LOC_Os12g28640.1 downstream_gene_variant ; 1001.0bp to feature; MODIFIER silent_mutation Average:21.58; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg1216930362 A -> G LOC_Os12g28630-LOC_Os12g28640 intergenic_region ; MODIFIER silent_mutation Average:21.58; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216930362 NA 7.32E-06 mr1071 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216930362 NA 8.84E-09 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216930362 NA 2.95E-06 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216930362 1.80E-06 NA mr1071_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216930362 5.77E-08 5.15E-09 mr1080_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216930362 4.91E-07 NA mr1100_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216930362 NA 2.13E-06 mr1124_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216930362 1.31E-08 3.36E-08 mr1203_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216930362 6.52E-08 3.04E-09 mr1613_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216930362 4.97E-08 4.63E-08 mr1619_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216930362 5.99E-06 NA mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251