| Variant ID: vg1216930362 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16930362 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.59, A: 0.41, others allele: 0.00, population size: 69. )
GTTCGCGGGATGCCCTAGAAGAACTTATCGTACTTACCACAAGCCAGCGTGGGCAACGGCTGGGCTTGTAGTATAGCTTTTCTCTAGCTGACGCATCCAG[A/G]
CAAGGGTGGGCGTGATGGAGTTTGGATGGGCCCTGCGACGGCCTATACGGCTTCCGGATTCACCTAGGCACGAGAGGGGACTGCCCGTCGCCCGCTGGGG
CCCCAGCGGGCGACGGGCAGTCCCCTCTCGTGCCTAGGTGAATCCGGAAGCCGTATAGGCCGTCGCAGGGCCCATCCAAACTCCATCACGCCCACCCTTG[T/C]
CTGGATGCGTCAGCTAGAGAAAAGCTATACTACAAGCCCAGCCGTTGCCCACGCTGGCTTGTGGTAAGTACGATAAGTTCTTCTAGGGCATCCCGCGAAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.00% | 6.70% | 39.00% | 22.34% | NA |
| All Indica | 2759 | 12.20% | 8.80% | 56.36% | 22.69% | NA |
| All Japonica | 1512 | 71.80% | 3.00% | 4.63% | 20.57% | NA |
| Aus | 269 | 15.20% | 5.90% | 47.21% | 31.60% | NA |
| Indica I | 595 | 26.40% | 8.40% | 36.47% | 28.74% | NA |
| Indica II | 465 | 8.00% | 4.30% | 62.15% | 25.59% | NA |
| Indica III | 913 | 2.60% | 12.80% | 67.47% | 17.09% | NA |
| Indica Intermediate | 786 | 15.00% | 7.00% | 55.09% | 22.90% | NA |
| Temperate Japonica | 767 | 94.00% | 0.10% | 1.69% | 4.17% | NA |
| Tropical Japonica | 504 | 34.90% | 8.50% | 7.94% | 48.61% | NA |
| Japonica Intermediate | 241 | 78.40% | 0.40% | 7.05% | 14.11% | NA |
| VI/Aromatic | 96 | 4.20% | 11.50% | 63.54% | 20.83% | NA |
| Intermediate | 90 | 47.80% | 3.30% | 33.33% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216930362 | A -> DEL | N | N | silent_mutation | Average:21.58; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| vg1216930362 | A -> G | LOC_Os12g28630.1 | upstream_gene_variant ; 1303.0bp to feature; MODIFIER | silent_mutation | Average:21.58; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| vg1216930362 | A -> G | LOC_Os12g28620.1 | downstream_gene_variant ; 3410.0bp to feature; MODIFIER | silent_mutation | Average:21.58; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| vg1216930362 | A -> G | LOC_Os12g28640.1 | downstream_gene_variant ; 1001.0bp to feature; MODIFIER | silent_mutation | Average:21.58; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| vg1216930362 | A -> G | LOC_Os12g28630-LOC_Os12g28640 | intergenic_region ; MODIFIER | silent_mutation | Average:21.58; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216930362 | NA | 7.32E-06 | mr1071 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216930362 | NA | 8.84E-09 | mr1275 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216930362 | NA | 2.95E-06 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216930362 | 1.80E-06 | NA | mr1071_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216930362 | 5.77E-08 | 5.15E-09 | mr1080_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216930362 | 4.91E-07 | NA | mr1100_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216930362 | NA | 2.13E-06 | mr1124_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216930362 | 1.31E-08 | 3.36E-08 | mr1203_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216930362 | 6.52E-08 | 3.04E-09 | mr1613_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216930362 | 4.97E-08 | 4.63E-08 | mr1619_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216930362 | 5.99E-06 | NA | mr1962_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |