\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216808328:

Variant ID: vg1216808328 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16808328
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAAAGATATGAACTATGCGAAGTTCTGGAACTGAAGCCCCATCTTCAAGCGCCGCAACCCAGTCGAAGTCAGCTAAAGGTTCAACCAGGGACAAGTCAGG[C/T]
GAAGAGAAGATTCCATCTGCAACAAGGGATCGAGCCAAGCAGCCTAGAGTGGCGAAGTTTTGCTAGGCAAGTTTGTTATAAAAGACGCGACGGAAGAAGT

Reverse complement sequence

ACTTCTTCCGTCGCGTCTTTTATAACAAACTTGCCTAGCAAAACTTCGCCACTCTAGGCTGCTTGGCTCGATCCCTTGTTGCAGATGGAATCTTCTCTTC[G/A]
CCTGACTTGTCCCTGGTTGAACCTTTAGCTGACTTCGACTGGGTTGCGGCGCTTGAAGATGGGGCTTCAGTTCCAGAACTTCGCATAGTTCATATCTTTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.70% 32.50% 34.74% 0.02% NA
All Indica  2759 25.60% 23.50% 50.82% 0.04% NA
All Japonica  1512 36.40% 52.50% 11.11% 0.00% NA
Aus  269 68.00% 17.10% 14.87% 0.00% NA
Indica I  595 27.10% 46.20% 26.72% 0.00% NA
Indica II  465 23.70% 25.60% 50.54% 0.22% NA
Indica III  913 25.50% 6.10% 68.35% 0.00% NA
Indica Intermediate  786 25.80% 25.30% 48.85% 0.00% NA
Temperate Japonica  767 5.20% 84.60% 10.17% 0.00% NA
Tropical Japonica  504 79.60% 14.10% 6.35% 0.00% NA
Japonica Intermediate  241 45.20% 30.70% 24.07% 0.00% NA
VI/Aromatic  96 80.20% 10.40% 9.38% 0.00% NA
Intermediate  90 33.30% 41.10% 25.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216808328 C -> DEL N N silent_mutation Average:35.747; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 N N N N
vg1216808328 C -> T LOC_Os12g28420.1 upstream_gene_variant ; 4123.0bp to feature; MODIFIER silent_mutation Average:35.747; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 N N N N
vg1216808328 C -> T LOC_Os12g28430.1 downstream_gene_variant ; 529.0bp to feature; MODIFIER silent_mutation Average:35.747; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 N N N N
vg1216808328 C -> T LOC_Os12g28440.1 downstream_gene_variant ; 718.0bp to feature; MODIFIER silent_mutation Average:35.747; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 N N N N
vg1216808328 C -> T LOC_Os12g28450.1 downstream_gene_variant ; 4598.0bp to feature; MODIFIER silent_mutation Average:35.747; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 N N N N
vg1216808328 C -> T LOC_Os12g28430-LOC_Os12g28440 intergenic_region ; MODIFIER silent_mutation Average:35.747; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216808328 7.13E-06 NA mr1104 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216808328 NA 9.53E-06 mr1577 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216808328 NA 4.15E-09 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216808328 6.80E-06 NA mr1070_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216808328 6.15E-07 NA mr1103_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216808328 1.39E-08 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216808328 1.07E-06 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216808328 4.93E-06 NA mr1145_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216808328 NA 4.68E-06 mr1155_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216808328 2.85E-10 NA mr1226_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216808328 2.73E-06 NA mr1437_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216808328 NA 2.09E-06 mr1437_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216808328 1.23E-06 NA mr1949_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251