| Variant ID: vg1216808328 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16808328 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CAAAGATATGAACTATGCGAAGTTCTGGAACTGAAGCCCCATCTTCAAGCGCCGCAACCCAGTCGAAGTCAGCTAAAGGTTCAACCAGGGACAAGTCAGG[C/T]
GAAGAGAAGATTCCATCTGCAACAAGGGATCGAGCCAAGCAGCCTAGAGTGGCGAAGTTTTGCTAGGCAAGTTTGTTATAAAAGACGCGACGGAAGAAGT
ACTTCTTCCGTCGCGTCTTTTATAACAAACTTGCCTAGCAAAACTTCGCCACTCTAGGCTGCTTGGCTCGATCCCTTGTTGCAGATGGAATCTTCTCTTC[G/A]
CCTGACTTGTCCCTGGTTGAACCTTTAGCTGACTTCGACTGGGTTGCGGCGCTTGAAGATGGGGCTTCAGTTCCAGAACTTCGCATAGTTCATATCTTTG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.70% | 32.50% | 34.74% | 0.02% | NA |
| All Indica | 2759 | 25.60% | 23.50% | 50.82% | 0.04% | NA |
| All Japonica | 1512 | 36.40% | 52.50% | 11.11% | 0.00% | NA |
| Aus | 269 | 68.00% | 17.10% | 14.87% | 0.00% | NA |
| Indica I | 595 | 27.10% | 46.20% | 26.72% | 0.00% | NA |
| Indica II | 465 | 23.70% | 25.60% | 50.54% | 0.22% | NA |
| Indica III | 913 | 25.50% | 6.10% | 68.35% | 0.00% | NA |
| Indica Intermediate | 786 | 25.80% | 25.30% | 48.85% | 0.00% | NA |
| Temperate Japonica | 767 | 5.20% | 84.60% | 10.17% | 0.00% | NA |
| Tropical Japonica | 504 | 79.60% | 14.10% | 6.35% | 0.00% | NA |
| Japonica Intermediate | 241 | 45.20% | 30.70% | 24.07% | 0.00% | NA |
| VI/Aromatic | 96 | 80.20% | 10.40% | 9.38% | 0.00% | NA |
| Intermediate | 90 | 33.30% | 41.10% | 25.56% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216808328 | C -> DEL | N | N | silent_mutation | Average:35.747; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 | N | N | N | N |
| vg1216808328 | C -> T | LOC_Os12g28420.1 | upstream_gene_variant ; 4123.0bp to feature; MODIFIER | silent_mutation | Average:35.747; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 | N | N | N | N |
| vg1216808328 | C -> T | LOC_Os12g28430.1 | downstream_gene_variant ; 529.0bp to feature; MODIFIER | silent_mutation | Average:35.747; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 | N | N | N | N |
| vg1216808328 | C -> T | LOC_Os12g28440.1 | downstream_gene_variant ; 718.0bp to feature; MODIFIER | silent_mutation | Average:35.747; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 | N | N | N | N |
| vg1216808328 | C -> T | LOC_Os12g28450.1 | downstream_gene_variant ; 4598.0bp to feature; MODIFIER | silent_mutation | Average:35.747; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 | N | N | N | N |
| vg1216808328 | C -> T | LOC_Os12g28430-LOC_Os12g28440 | intergenic_region ; MODIFIER | silent_mutation | Average:35.747; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216808328 | 7.13E-06 | NA | mr1104 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216808328 | NA | 9.53E-06 | mr1577 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216808328 | NA | 4.15E-09 | mr1959 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216808328 | 6.80E-06 | NA | mr1070_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216808328 | 6.15E-07 | NA | mr1103_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216808328 | 1.39E-08 | NA | mr1104_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216808328 | 1.07E-06 | NA | mr1107_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216808328 | 4.93E-06 | NA | mr1145_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216808328 | NA | 4.68E-06 | mr1155_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216808328 | 2.85E-10 | NA | mr1226_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216808328 | 2.73E-06 | NA | mr1437_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216808328 | NA | 2.09E-06 | mr1437_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216808328 | 1.23E-06 | NA | mr1949_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |