| Variant ID: vg1216747487 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16747487 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 51. )
ATTCCTATTCTAATTCTATTCCACCAGCTAGATACTACTAAACTAAACTTGAGAGGAATGAGAGAGCTCTTGCTTGAGGTGTATGTTGAAGTGAAGAGAG[C/T]
GAGCTCCTTATATAGAGGTAGGTATGACGGTTGTGGAAGGGGAGTTGTCCGAAGTACCCTCCAACCGCCATTAGGAGAAGATCTGGAGCGTCCCTGCCAA
TTGGCAGGGACGCTCCAGATCTTCTCCTAATGGCGGTTGGAGGGTACTTCGGACAACTCCCCTTCCACAACCGTCATACCTACCTCTATATAAGGAGCTC[G/A]
CTCTCTTCACTTCAACATACACCTCAAGCAAGAGCTCTCTCATTCCTCTCAAGTTTAGTTTAGTAGTATCTAGCTGGTGGAATAGAATTAGAATAGGAAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.30% | 14.40% | 39.04% | 6.28% | NA |
| All Indica | 2759 | 23.10% | 14.60% | 52.41% | 9.97% | NA |
| All Japonica | 1512 | 75.90% | 7.50% | 15.87% | 0.66% | NA |
| Aus | 269 | 24.20% | 46.10% | 26.02% | 3.72% | NA |
| Indica I | 595 | 48.20% | 9.70% | 29.75% | 12.27% | NA |
| Indica II | 465 | 26.20% | 8.00% | 48.17% | 17.63% | NA |
| Indica III | 913 | 2.20% | 20.70% | 73.27% | 3.83% | NA |
| Indica Intermediate | 786 | 26.30% | 15.00% | 47.84% | 10.81% | NA |
| Temperate Japonica | 767 | 96.20% | 0.40% | 2.61% | 0.78% | NA |
| Tropical Japonica | 504 | 42.70% | 19.00% | 37.70% | 0.60% | NA |
| Japonica Intermediate | 241 | 80.90% | 6.20% | 12.45% | 0.41% | NA |
| VI/Aromatic | 96 | 9.40% | 33.30% | 56.25% | 1.04% | NA |
| Intermediate | 90 | 52.20% | 7.80% | 38.89% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216747487 | C -> DEL | N | N | silent_mutation | Average:11.449; most accessible tissue: Callus, score: 20.294 | N | N | N | N |
| vg1216747487 | C -> T | LOC_Os12g28310.1 | downstream_gene_variant ; 4224.0bp to feature; MODIFIER | silent_mutation | Average:11.449; most accessible tissue: Callus, score: 20.294 | N | N | N | N |
| vg1216747487 | C -> T | LOC_Os12g28310-LOC_Os12g28330 | intergenic_region ; MODIFIER | silent_mutation | Average:11.449; most accessible tissue: Callus, score: 20.294 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216747487 | NA | 6.17E-35 | mr1017 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216747487 | NA | 5.77E-29 | mr1022 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216747487 | NA | 6.83E-34 | mr1055 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216747487 | NA | 6.75E-06 | mr1334 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216747487 | 6.04E-06 | NA | mr1491 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216747487 | NA | 4.65E-39 | mr1022_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216747487 | 5.65E-07 | NA | mr1022_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216747487 | 3.33E-06 | NA | mr1023_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216747487 | NA | 6.27E-54 | mr1079_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216747487 | 4.30E-07 | 1.79E-09 | mr1489_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |