\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216729879:

Variant ID: vg1216729879 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16729879
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, C: 0.06, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:


CTAAACGGCGTGATGAATGAAGTCTTCAAGCAGTCGGATTCTTTCAATCGGATCTGATGATATCCAGAGTAGCAATCCAAAAAACTGAGTAGCTCGCAGC[T/C]
GGCGGTCGAGTCAACTACCTGGTCAATGCGAGGCAACCCAAAAGGATCTTTGGGGCAAGACTTGTTGAGGTCGGTGTAATCGACACACATGCGCCATTGC

Reverse complement sequence

GCAATGGCGCATGTGTGTCGATTACACCGACCTCAACAAGTCTTGCCCCAAAGATCCTTTTGGGTTGCCTCGCATTGACCAGGTAGTTGACTCGACCGCC[A/G]
GCTGCGAGCTACTCAGTTTTTTGGATTGCTACTCTGGATATCATCAGATCCGATTGAAAGAATCCGACTGCTTGAAGACTTCATTCATCACGCCGTTTAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.30% 26.90% 15.40% 2.45% NA
All Indica  2759 81.00% 4.90% 13.30% 0.80% NA
All Japonica  1512 6.90% 71.10% 16.14% 5.89% NA
Aus  269 73.60% 9.30% 15.99% 1.12% NA
Indica I  595 72.10% 4.70% 21.01% 2.18% NA
Indica II  465 76.60% 4.50% 18.49% 0.43% NA
Indica III  913 89.80% 3.90% 6.13% 0.11% NA
Indica Intermediate  786 80.20% 6.40% 12.72% 0.76% NA
Temperate Japonica  767 1.40% 92.80% 3.91% 1.83% NA
Tropical Japonica  504 14.50% 34.50% 37.70% 13.29% NA
Japonica Intermediate  241 8.30% 78.40% 9.96% 3.32% NA
VI/Aromatic  96 38.50% 2.10% 58.33% 1.04% NA
Intermediate  90 43.30% 35.60% 20.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216729879 T -> C LOC_Os12g28290.1 missense_variant ; p.Ser793Gly; MODERATE nonsynonymous_codon ; S793G Average:10.684; most accessible tissue: Zhenshan97 panicle, score: 16.188 benign -0.91 TOLERATED 1.00
vg1216729879 T -> DEL LOC_Os12g28290.1 N frameshift_variant Average:10.684; most accessible tissue: Zhenshan97 panicle, score: 16.188 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216729879 NA 8.80E-45 mr1016 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879 NA 1.17E-37 mr1017 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879 NA 1.83E-30 mr1022 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879 NA 4.26E-38 mr1055 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879 NA 1.24E-48 mr1079 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879 NA 6.65E-64 mr1142 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879 NA 3.12E-18 mr1308 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879 NA 1.41E-64 mr1491 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879 NA 1.98E-12 mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879 2.20E-06 4.87E-47 mr1022_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879 8.49E-09 7.27E-82 mr1023_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879 1.82E-07 3.55E-10 mr1023_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879 NA 3.27E-50 mr1055_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879 1.44E-06 2.88E-65 mr1079_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879 NA 2.62E-74 mr1178_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879 NA 3.66E-21 mr1308_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879 NA 3.20E-09 mr1347_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879 NA 5.62E-60 mr1390_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879 NA 4.72E-06 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879 NA 2.70E-79 mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879 NA 1.43E-09 mr1489_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879 NA 1.47E-62 mr1490_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879 NA 1.46E-07 mr1606_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879 NA 1.36E-06 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879 NA 1.88E-16 mr1730_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879 NA 2.25E-11 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879 NA 1.38E-13 mr1853_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879 NA 7.84E-11 mr1942_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251