Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216729879:

Variant ID: vg1216729879 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 16729879
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, C: 0.06, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:

CTAAACGGCGTGATGAATGAAGTCTTCAAGCAGTCGGATTCTTTCAATCGGATCTGATGATATCCAGAGTAGCAATCCAAAAAACTGAGTAGCTCGCAGC[T/C]
GGCGGTCGAGTCAACTACCTGGTCAATGCGAGGCAACCCAAAAGGATCTTTGGGGCAAGACTTGTTGAGGTCGGTGTAATCGACACACATGCGCCATTGC

Reverse complement sequence

GCAATGGCGCATGTGTGTCGATTACACCGACCTCAACAAGTCTTGCCCCAAAGATCCTTTTGGGTTGCCTCGCATTGACCAGGTAGTTGACTCGACCGCC[A/G]
GCTGCGAGCTACTCAGTTTTTTGGATTGCTACTCTGGATATCATCAGATCCGATTGAAAGAATCCGACTGCTTGAAGACTTCATTCATCACGCCGTTTAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.30%	26.90%	15.40%	2.45%	NA
All Indica	2759	81.00%	4.90%	13.30%	0.80%	NA
All Japonica	1512	6.90%	71.10%	16.14%	5.89%	NA
Aus	269	73.60%	9.30%	15.99%	1.12%	NA
Indica I	595	72.10%	4.70%	21.01%	2.18%	NA
Indica II	465	76.60%	4.50%	18.49%	0.43%	NA
Indica III	913	89.80%	3.90%	6.13%	0.11%	NA
Indica Intermediate	786	80.20%	6.40%	12.72%	0.76%	NA
Temperate Japonica	767	1.40%	92.80%	3.91%	1.83%	NA
Tropical Japonica	504	14.50%	34.50%	37.70%	13.29%	NA
Japonica Intermediate	241	8.30%	78.40%	9.96%	3.32%	NA
VI/Aromatic	96	38.50%	2.10%	58.33%	1.04%	NA
Intermediate	90	43.30%	35.60%	20.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216729879	T -> C	LOC_Os12g28290.1	missense_variant ; p.Ser793Gly; MODERATE	nonsynonymous_codon ; S793G	Average:10.684; most accessible tissue: Zhenshan97 panicle, score: 16.188	benign	-0.91	TOLERATED	1.00
vg1216729879	T -> DEL	LOC_Os12g28290.1	N	frameshift_variant	Average:10.684; most accessible tissue: Zhenshan97 panicle, score: 16.188	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216729879	NA	8.80E-45	mr1016	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879	NA	1.17E-37	mr1017	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879	NA	1.83E-30	mr1022	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879	NA	4.26E-38	mr1055	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879	NA	1.24E-48	mr1079	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879	NA	6.65E-64	mr1142	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879	NA	3.12E-18	mr1308	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879	NA	1.41E-64	mr1491	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879	NA	1.98E-12	mr1667	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879	2.20E-06	4.87E-47	mr1022_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879	8.49E-09	7.27E-82	mr1023_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879	1.82E-07	3.55E-10	mr1023_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879	NA	3.27E-50	mr1055_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879	1.44E-06	2.88E-65	mr1079_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879	NA	2.62E-74	mr1178_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879	NA	3.66E-21	mr1308_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879	NA	3.20E-09	mr1347_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879	NA	5.62E-60	mr1390_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879	NA	4.72E-06	mr1398_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879	NA	2.70E-79	mr1489_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879	NA	1.43E-09	mr1489_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879	NA	1.47E-62	mr1490_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879	NA	1.46E-07	mr1606_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879	NA	1.36E-06	mr1653_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879	NA	1.88E-16	mr1730_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879	NA	2.25E-11	mr1830_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879	NA	1.38E-13	mr1853_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216729879	NA	7.84E-11	mr1942_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251