Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216728500:

Variant ID: vg1216728500 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 16728500
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, G: 0.02, others allele: 0.00, population size: 45. )

Flanking Sequence (100 bp) in Reference Genome:

AAAGATGTTCGGCGAACACGTCGGAAGGAGCTGCTTCGCGTTTGGAACCGAAGTTAGCGAGTCTGTCGGCTGCTTCGTTATTGTGCCGAAGGACGTGGGT[T/G]
AGTTCGAGCCCATCAAACTTGTCTTCCAACTTGCATACCTCTTGCCGATAGGCGGTCATGTTGTCATCAAGGCAGGACCACTCTTTCATAACTTGATTAA

Reverse complement sequence

TTAATCAAGTTATGAAAGAGTGGTCCTGCCTTGATGACAACATGACCGCCTATCGGCAAGAGGTATGCAAGTTGGAAGACAAGTTTGATGGGCTCGAACT[A/C]
ACCCACGTCCTTCGGCACAATAACGAAGCAGCCGACAGACTCGCTAACTTCGGTTCCAAACGCGAAGCAGCTCCTTCCGACGTGTTCGCCGAACATCTTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	25.40%	2.80%	24.84%	46.95%	NA
All Indica	2759	3.30%	4.10%	36.93%	55.67%	NA
All Japonica	1512	69.40%	0.00%	3.04%	27.51%	NA
Aus	269	8.20%	5.20%	18.96%	67.66%	NA
Indica I	595	3.40%	3.50%	28.24%	64.87%	NA
Indica II	465	4.70%	2.60%	29.89%	62.80%	NA
Indica III	913	0.40%	4.70%	47.75%	47.10%	NA
Indica Intermediate	786	5.90%	4.60%	35.11%	54.45%	NA
Temperate Japonica	767	92.40%	0.00%	0.00%	7.56%	NA
Tropical Japonica	504	31.20%	0.00%	7.54%	61.31%	NA
Japonica Intermediate	241	76.30%	0.00%	3.32%	20.33%	NA
VI/Aromatic	96	2.10%	5.20%	43.75%	48.96%	NA
Intermediate	90	36.70%	3.30%	17.78%	42.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216728500	T -> DEL	LOC_Os12g28290.1	N	frameshift_variant	Average:7.687; most accessible tissue: Callus, score: 17.979	N	N	N	N
vg1216728500	T -> G	LOC_Os12g28290.1	synonymous_variant ; p.Leu1252Leu; LOW	synonymous_codon	Average:7.687; most accessible tissue: Callus, score: 17.979	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216728500	NA	5.16E-48	mr1016	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728500	NA	2.83E-39	mr1017	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728500	NA	2.45E-33	mr1022	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728500	NA	1.99E-60	mr1023	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728500	NA	1.85E-37	mr1055	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728500	NA	1.08E-50	mr1079	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728500	NA	1.99E-63	mr1142	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728500	NA	2.95E-56	mr1178	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728500	NA	9.62E-17	mr1308	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728500	NA	3.52E-55	mr1390	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728500	NA	7.53E-56	mr1490	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728500	NA	4.14E-66	mr1491	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728500	NA	2.39E-37	mr1601	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728500	NA	1.85E-13	mr1667	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728500	NA	1.63E-21	mr1698	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728500	NA	4.26E-45	mr1022_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728500	NA	6.43E-74	mr1023_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728500	NA	2.57E-52	mr1055_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728500	NA	2.75E-60	mr1079_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728500	NA	6.04E-78	mr1132_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728500	NA	4.24E-77	mr1178_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728500	2.37E-06	2.37E-06	mr1325_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728500	NA	1.72E-63	mr1390_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728500	NA	8.11E-22	mr1401_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728500	NA	8.68E-76	mr1489_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728500	NA	4.49E-65	mr1490_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728500	NA	7.18E-07	mr1686_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251