\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216724376:

Variant ID: vg1216724376 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16724376
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, others allele: 0.00, population size: 45. )

Flanking Sequence (100 bp) in Reference Genome:


ACCTCACTAGGAAACATTGCTTCTGCTCCATAAACTAAGAAGAACGGCGACTGGCCCGTGGCCCGACTGAGAGTGGTGCGCAAGGACCAAAGTACCGACG[A/G]
CAGCTGTTCTACCCACTTGCCGGCATAGGGATTCAGTCGGTCGAAAACTTGTGCCTTTATTCCTTGGAGTACCATGCCGTTATCTCGTTCGACTTGTCCA

Reverse complement sequence

TGGACAAGTCGAACGAGATAACGGCATGGTACTCCAAGGAATAAAGGCACAAGTTTTCGACCGACTGAATCCCTATGCCGGCAAGTGGGTAGAACAGCTG[T/C]
CGTCGGTACTTTGGTCCTTGCGCACCACTCTCAGTCGGGCCACGGGCCAGTCGCCGTTCTTCTTAGTTTATGGAGCAGAAGCAATGTTTCCTAGTGAGGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.90% 28.30% 19.59% 5.14% NA
All Indica  2759 71.00% 5.10% 19.97% 3.91% NA
All Japonica  1512 7.80% 69.40% 14.48% 8.27% NA
Aus  269 37.90% 16.00% 43.87% 2.23% NA
Indica I  595 46.90% 5.40% 38.15% 9.58% NA
Indica II  465 72.30% 4.30% 20.00% 3.44% NA
Indica III  913 88.00% 3.50% 8.21% 0.33% NA
Indica Intermediate  786 68.80% 7.30% 19.85% 4.07% NA
Temperate Japonica  767 1.20% 92.60% 4.56% 1.69% NA
Tropical Japonica  504 17.50% 30.80% 31.94% 19.84% NA
Japonica Intermediate  241 8.70% 76.80% 9.54% 4.98% NA
VI/Aromatic  96 8.30% 72.90% 16.67% 2.08% NA
Intermediate  90 34.40% 38.90% 24.44% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216724376 A -> DEL N N silent_mutation Average:11.117; most accessible tissue: Callus, score: 34.828 N N N N
vg1216724376 A -> G LOC_Os12g28280.1 downstream_gene_variant ; 795.0bp to feature; MODIFIER silent_mutation Average:11.117; most accessible tissue: Callus, score: 34.828 N N N N
vg1216724376 A -> G LOC_Os12g28290.1 downstream_gene_variant ; 3929.0bp to feature; MODIFIER silent_mutation Average:11.117; most accessible tissue: Callus, score: 34.828 N N N N
vg1216724376 A -> G LOC_Os12g28280-LOC_Os12g28290 intergenic_region ; MODIFIER silent_mutation Average:11.117; most accessible tissue: Callus, score: 34.828 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216724376 1.64E-06 NA mr1079 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216724376 5.06E-06 NA mr1079 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216724376 5.40E-06 NA mr1390 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216724376 5.51E-06 NA mr1390 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216724376 2.51E-06 NA mr1490 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216724376 NA 7.26E-06 mr1200_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216724376 NA 5.07E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216724376 8.40E-06 NA mr1490_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251