| Variant ID: vg1216724376 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16724376 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, others allele: 0.00, population size: 45. )
ACCTCACTAGGAAACATTGCTTCTGCTCCATAAACTAAGAAGAACGGCGACTGGCCCGTGGCCCGACTGAGAGTGGTGCGCAAGGACCAAAGTACCGACG[A/G]
CAGCTGTTCTACCCACTTGCCGGCATAGGGATTCAGTCGGTCGAAAACTTGTGCCTTTATTCCTTGGAGTACCATGCCGTTATCTCGTTCGACTTGTCCA
TGGACAAGTCGAACGAGATAACGGCATGGTACTCCAAGGAATAAAGGCACAAGTTTTCGACCGACTGAATCCCTATGCCGGCAAGTGGGTAGAACAGCTG[T/C]
CGTCGGTACTTTGGTCCTTGCGCACCACTCTCAGTCGGGCCACGGGCCAGTCGCCGTTCTTCTTAGTTTATGGAGCAGAAGCAATGTTTCCTAGTGAGGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 46.90% | 28.30% | 19.59% | 5.14% | NA |
| All Indica | 2759 | 71.00% | 5.10% | 19.97% | 3.91% | NA |
| All Japonica | 1512 | 7.80% | 69.40% | 14.48% | 8.27% | NA |
| Aus | 269 | 37.90% | 16.00% | 43.87% | 2.23% | NA |
| Indica I | 595 | 46.90% | 5.40% | 38.15% | 9.58% | NA |
| Indica II | 465 | 72.30% | 4.30% | 20.00% | 3.44% | NA |
| Indica III | 913 | 88.00% | 3.50% | 8.21% | 0.33% | NA |
| Indica Intermediate | 786 | 68.80% | 7.30% | 19.85% | 4.07% | NA |
| Temperate Japonica | 767 | 1.20% | 92.60% | 4.56% | 1.69% | NA |
| Tropical Japonica | 504 | 17.50% | 30.80% | 31.94% | 19.84% | NA |
| Japonica Intermediate | 241 | 8.70% | 76.80% | 9.54% | 4.98% | NA |
| VI/Aromatic | 96 | 8.30% | 72.90% | 16.67% | 2.08% | NA |
| Intermediate | 90 | 34.40% | 38.90% | 24.44% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216724376 | A -> DEL | N | N | silent_mutation | Average:11.117; most accessible tissue: Callus, score: 34.828 | N | N | N | N |
| vg1216724376 | A -> G | LOC_Os12g28280.1 | downstream_gene_variant ; 795.0bp to feature; MODIFIER | silent_mutation | Average:11.117; most accessible tissue: Callus, score: 34.828 | N | N | N | N |
| vg1216724376 | A -> G | LOC_Os12g28290.1 | downstream_gene_variant ; 3929.0bp to feature; MODIFIER | silent_mutation | Average:11.117; most accessible tissue: Callus, score: 34.828 | N | N | N | N |
| vg1216724376 | A -> G | LOC_Os12g28280-LOC_Os12g28290 | intergenic_region ; MODIFIER | silent_mutation | Average:11.117; most accessible tissue: Callus, score: 34.828 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216724376 | 1.64E-06 | NA | mr1079 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216724376 | 5.06E-06 | NA | mr1079 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216724376 | 5.40E-06 | NA | mr1390 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216724376 | 5.51E-06 | NA | mr1390 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216724376 | 2.51E-06 | NA | mr1490 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216724376 | NA | 7.26E-06 | mr1200_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216724376 | NA | 5.07E-06 | mr1211_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216724376 | 8.40E-06 | NA | mr1490_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |