\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216702317:

Variant ID: vg1216702317 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16702317
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.83, T: 0.17, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


AAATGGACTTAACCCTATAAAATTTAATTAAAAAGCATAATACTTAGACCTAAATCTTTTTATGTTCGTACAAAAATTTTGAATAAGATGAATGATCAAA[C/T]
GTTTGTAAAAAAGTTAACGGGATGACATAGGAGTACATAAAAAATGGAGGTAGTATTTACTCAACTTCCATGACTGCGTCCCAGATTATTGCTTAGTGGA

Reverse complement sequence

TCCACTAAGCAATAATCTGGGACGCAGTCATGGAAGTTGAGTAAATACTACCTCCATTTTTTATGTACTCCTATGTCATCCCGTTAACTTTTTTACAAAC[G/A]
TTTGATCATTCATCTTATTCAAAATTTTTGTACGAACATAAAAAGATTTAGGTCTAAGTATTATGCTTTTTAATTAAATTTTATAGGGTTAAGTCCATTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.40% 10.30% 0.11% 16.21% NA
All Indica  2759 75.90% 11.60% 0.04% 12.50% NA
All Japonica  1512 74.90% 8.80% 0.07% 16.27% NA
Aus  269 61.70% 6.30% 0.37% 31.60% NA
Indica I  595 90.10% 8.40% 0.00% 1.51% NA
Indica II  465 60.20% 20.60% 0.00% 19.14% NA
Indica III  913 73.90% 12.50% 0.11% 13.47% NA
Indica Intermediate  786 76.60% 7.60% 0.00% 15.78% NA
Temperate Japonica  767 97.30% 2.50% 0.00% 0.26% NA
Tropical Japonica  504 35.70% 19.20% 0.00% 45.04% NA
Japonica Intermediate  241 85.50% 7.10% 0.41% 7.05% NA
VI/Aromatic  96 12.50% 9.40% 2.08% 76.04% NA
Intermediate  90 72.20% 8.90% 0.00% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216702317 C -> DEL N N silent_mutation Average:48.402; most accessible tissue: Zhenshan97 flower, score: 71.688 N N N N
vg1216702317 C -> T LOC_Os12g28260.1 upstream_gene_variant ; 196.0bp to feature; MODIFIER silent_mutation Average:48.402; most accessible tissue: Zhenshan97 flower, score: 71.688 N N N N
vg1216702317 C -> T LOC_Os12g28270.1 downstream_gene_variant ; 4254.0bp to feature; MODIFIER silent_mutation Average:48.402; most accessible tissue: Zhenshan97 flower, score: 71.688 N N N N
vg1216702317 C -> T LOC_Os12g28270.2 downstream_gene_variant ; 3239.0bp to feature; MODIFIER silent_mutation Average:48.402; most accessible tissue: Zhenshan97 flower, score: 71.688 N N N N
vg1216702317 C -> T LOC_Os12g28250-LOC_Os12g28260 intergenic_region ; MODIFIER silent_mutation Average:48.402; most accessible tissue: Zhenshan97 flower, score: 71.688 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216702317 NA 3.59E-12 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216702317 NA 1.58E-11 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216702317 5.82E-06 3.87E-13 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216702317 4.00E-06 1.44E-13 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216702317 NA 3.31E-12 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216702317 NA 1.29E-07 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216702317 NA 4.00E-14 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216702317 2.31E-06 4.31E-15 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216702317 NA 6.55E-06 mr1686 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216702317 NA 6.90E-06 mr1790 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216702317 NA 6.85E-11 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216702317 NA 9.75E-09 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216702317 9.12E-07 1.23E-15 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216702317 NA 2.48E-15 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216702317 9.85E-08 5.18E-17 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216702317 NA 2.04E-08 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216702317 3.95E-09 2.92E-19 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216702317 6.54E-08 3.66E-18 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216702317 6.76E-06 4.43E-06 mr1882_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216702317 NA 5.44E-09 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251