| Variant ID: vg1216676408 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16676408 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TAAGAATGGTTGGGCCTATGCAACAGGGTATGTTGTATAGCGTTGGATTAATATTGTTTAATTATTACTTAACTGTTTTATTAAATTCTGAAATGTTTAT[G/T]
AAATGTTGTTTATGCAAATGAAACCCTACTATGCCATCCTTTGTTATCCTGTGCACTTGCATATTTGCTGCGTGGCTTGCTGAGTATGTCATATACTCAC
GTGAGTATATGACATACTCAGCAAGCCACGCAGCAAATATGCAAGTGCACAGGATAACAAAGGATGGCATAGTAGGGTTTCATTTGCATAAACAACATTT[C/A]
ATAAACATTTCAGAATTTAATAAAACAGTTAAGTAATAATTAAACAATATTAATCCAACGCTATACAACATACCCTGTTGCATAGGCCCAACCATTCTTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 19.00% | 6.90% | 6.90% | 67.29% | NA |
| All Indica | 2759 | 2.40% | 0.40% | 10.98% | 86.19% | NA |
| All Japonica | 1512 | 52.80% | 18.90% | 0.60% | 27.71% | NA |
| Aus | 269 | 1.90% | 7.40% | 1.49% | 89.22% | NA |
| Indica I | 595 | 2.00% | 0.20% | 1.68% | 96.13% | NA |
| Indica II | 465 | 2.60% | 0.40% | 8.82% | 88.17% | NA |
| Indica III | 913 | 0.50% | 0.10% | 18.84% | 80.50% | NA |
| Indica Intermediate | 786 | 4.80% | 0.90% | 10.18% | 84.10% | NA |
| Temperate Japonica | 767 | 84.50% | 11.30% | 0.26% | 3.91% | NA |
| Tropical Japonica | 504 | 6.50% | 25.00% | 0.99% | 67.46% | NA |
| Japonica Intermediate | 241 | 48.50% | 30.30% | 0.83% | 20.33% | NA |
| VI/Aromatic | 96 | 1.00% | 0.00% | 4.17% | 94.79% | NA |
| Intermediate | 90 | 27.80% | 7.80% | 6.67% | 57.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216676408 | G -> DEL | N | N | silent_mutation | Average:10.579; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg1216676408 | G -> T | LOC_Os12g28220.1 | downstream_gene_variant ; 2463.0bp to feature; MODIFIER | silent_mutation | Average:10.579; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg1216676408 | G -> T | LOC_Os12g28230.1 | downstream_gene_variant ; 970.0bp to feature; MODIFIER | silent_mutation | Average:10.579; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg1216676408 | G -> T | LOC_Os12g28240.1 | downstream_gene_variant ; 357.0bp to feature; MODIFIER | silent_mutation | Average:10.579; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg1216676408 | G -> T | LOC_Os12g28230-LOC_Os12g28240 | intergenic_region ; MODIFIER | silent_mutation | Average:10.579; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216676408 | NA | 1.40E-18 | mr1308 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216676408 | 1.92E-07 | NA | mr1334 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216676408 | NA | 1.32E-12 | mr1853 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216676408 | NA | 9.96E-12 | mr1011_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216676408 | NA | 6.55E-08 | mr1011_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216676408 | NA | 3.56E-16 | mr1162_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216676408 | 3.34E-07 | 3.34E-07 | mr1162_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216676408 | 7.08E-07 | NA | mr1334_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216676408 | NA | 1.01E-08 | mr1576_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216676408 | NA | 1.91E-07 | mr1749_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216676408 | NA | 1.28E-06 | mr1754_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216676408 | 7.06E-07 | 1.22E-10 | mr1821_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |