\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216596256:

Variant ID: vg1216596256 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16596256
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCATCTCTTCCTATTTCGGTGGAGAGCAAGTATAATAGTAGGCTATAAACTGGCTAAATATTAAGGTGGAGGAGAAAAGAGAGGAGAGAGAGGAGAAGCG[G/A]
GCTGTAAACTTACAGCTAGGCCTACCAGTGGACTGACTTTGCTTGGATTAAGTGGGCTGGATCCTCATTTGGATCATTTTGGTTGGATTGAAACGGCCTG

Reverse complement sequence

CAGGCCGTTTCAATCCAACCAAAATGATCCAAATGAGGATCCAGCCCACTTAATCCAAGCAAAGTCAGTCCACTGGTAGGCCTAGCTGTAAGTTTACAGC[C/T]
CGCTTCTCCTCTCTCTCCTCTCTTTTCTCCTCCACCTTAATATTTAGCCAGTTTATAGCCTACTATTATACTTGCTCTCCACCGAAATAGGAAGAGATGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.70% 2.50% 2.43% 48.37% NA
All Indica  2759 21.90% 3.60% 2.61% 71.87% NA
All Japonica  1512 89.20% 0.90% 2.71% 7.14% NA
Aus  269 40.90% 0.40% 0.00% 58.74% NA
Indica I  595 5.00% 3.50% 1.34% 90.08% NA
Indica II  465 43.00% 1.10% 1.08% 54.84% NA
Indica III  913 17.90% 4.40% 4.05% 73.71% NA
Indica Intermediate  786 27.00% 4.20% 2.80% 66.03% NA
Temperate Japonica  767 96.20% 0.10% 0.13% 3.52% NA
Tropical Japonica  504 79.40% 0.40% 7.94% 12.30% NA
Japonica Intermediate  241 87.60% 4.60% 0.00% 7.88% NA
VI/Aromatic  96 84.40% 1.00% 0.00% 14.58% NA
Intermediate  90 66.70% 5.60% 2.22% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216596256 G -> DEL N N silent_mutation Average:71.489; most accessible tissue: Minghui63 root, score: 99.729 N N N N
vg1216596256 G -> A LOC_Os12g28100.1 upstream_gene_variant ; 254.0bp to feature; MODIFIER silent_mutation Average:71.489; most accessible tissue: Minghui63 root, score: 99.729 N N N N
vg1216596256 G -> A LOC_Os12g28110.1 upstream_gene_variant ; 1069.0bp to feature; MODIFIER silent_mutation Average:71.489; most accessible tissue: Minghui63 root, score: 99.729 N N N N
vg1216596256 G -> A LOC_Os12g28100-LOC_Os12g28110 intergenic_region ; MODIFIER silent_mutation Average:71.489; most accessible tissue: Minghui63 root, score: 99.729 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1216596256 G A -0.02 -0.04 -0.01 -0.02 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216596256 2.19E-06 1.96E-13 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216596256 NA 3.75E-12 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216596256 1.87E-06 NA mr1018 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216596256 1.40E-07 6.54E-15 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216596256 NA 4.87E-09 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216596256 1.19E-06 NA mr1055 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216596256 3.24E-07 4.24E-14 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216596256 9.22E-06 NA mr1132 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216596256 2.04E-06 6.26E-14 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216596256 NA 1.67E-06 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216596256 5.25E-06 5.41E-14 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216596256 1.09E-06 1.03E-14 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216596256 7.66E-07 NA mr1491 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216596256 5.73E-06 NA mr1491 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216596256 9.84E-06 NA mr1778 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216596256 4.67E-06 6.60E-12 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216596256 NA 1.17E-09 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216596256 3.80E-07 NA mr1055_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216596256 3.12E-08 1.29E-16 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216596256 1.65E-06 NA mr1132_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216596256 2.91E-07 7.24E-17 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216596256 7.51E-08 NA mr1178_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216596256 6.03E-09 4.89E-18 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216596256 5.72E-06 NA mr1261_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216596256 NA 2.47E-09 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216596256 1.11E-06 NA mr1390_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216596256 4.71E-11 1.36E-20 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216596256 7.82E-06 NA mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216596256 2.43E-06 NA mr1490_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216596256 2.46E-10 4.39E-20 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216596256 NA 5.93E-09 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251