\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216569286:

Variant ID: vg1216569286 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16569286
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.08, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


TCCTGGTCATCAAATCAGGTCGAATCTTTCTCGATCTTTCAATATTGGTTAAGGGTCTCGTGTCTGTGCAATGCCAAAACCGATCCTCCCCATCAAATCC[A/G]
GTCGAATTTTTCTCGATCTTTTAAAATTAGTTAATGGTTTTTGATACACTTTATCTCCTCACTCGGGATAAGAATGGTGACTTTTAAATGGAGATTAAAT

Reverse complement sequence

ATTTAATCTCCATTTAAAAGTCACCATTCTTATCCCGAGTGAGGAGATAAAGTGTATCAAAAACCATTAACTAATTTTAAAAGATCGAGAAAAATTCGAC[T/C]
GGATTTGATGGGGAGGATCGGTTTTGGCATTGCACAGACACGAGACCCTTAACCAATATTGAAAGATCGAGAAAGATTCGACCTGATTTGATGACCAGGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.00% 24.40% 0.04% 14.58% NA
All Indica  2759 61.70% 14.00% 0.07% 24.28% NA
All Japonica  1512 50.70% 49.10% 0.00% 0.26% NA
Aus  269 98.50% 0.40% 0.00% 1.12% NA
Indica I  595 81.30% 7.10% 0.17% 11.43% NA
Indica II  465 83.70% 13.80% 0.22% 2.37% NA
Indica III  913 37.10% 14.60% 0.00% 48.30% NA
Indica Intermediate  786 62.20% 18.70% 0.00% 19.08% NA
Temperate Japonica  767 19.90% 79.80% 0.00% 0.26% NA
Tropical Japonica  504 94.80% 4.80% 0.00% 0.40% NA
Japonica Intermediate  241 56.00% 44.00% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 0.00% 0.00% 3.12% NA
Intermediate  90 63.30% 26.70% 0.00% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216569286 A -> DEL N N silent_mutation Average:44.354; most accessible tissue: Callus, score: 61.084 N N N N
vg1216569286 A -> G LOC_Os12g28065.1 upstream_gene_variant ; 3344.0bp to feature; MODIFIER silent_mutation Average:44.354; most accessible tissue: Callus, score: 61.084 N N N N
vg1216569286 A -> G LOC_Os12g28070.1 downstream_gene_variant ; 2649.0bp to feature; MODIFIER silent_mutation Average:44.354; most accessible tissue: Callus, score: 61.084 N N N N
vg1216569286 A -> G LOC_Os12g28065-LOC_Os12g28070 intergenic_region ; MODIFIER silent_mutation Average:44.354; most accessible tissue: Callus, score: 61.084 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216569286 NA 3.32E-29 mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216569286 NA 6.45E-09 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216569286 NA 1.30E-12 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216569286 NA 5.39E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216569286 NA 5.99E-07 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216569286 NA 3.00E-15 mr1401 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216569286 NA 4.45E-07 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216569286 NA 4.96E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216569286 NA 7.17E-09 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216569286 NA 3.92E-07 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216569286 3.40E-07 NA mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216569286 NA 1.16E-09 mr1089_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216569286 NA 5.48E-07 mr1129_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216569286 NA 4.83E-15 mr1162_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216569286 8.64E-07 8.64E-07 mr1162_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216569286 1.15E-06 NA mr1203_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216569286 NA 3.02E-07 mr1257_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216569286 NA 1.75E-16 mr1540_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216569286 NA 2.70E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216569286 2.22E-07 NA mr1613_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216569286 NA 2.80E-07 mr1629_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216569286 6.24E-06 NA mr1718_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216569286 6.21E-06 6.21E-06 mr1754_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216569286 NA 2.24E-09 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216569286 1.76E-06 1.41E-09 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251