\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216568179:

Variant ID: vg1216568179 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16568179
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCAAGAGAGAAAAAAATAGAAACGGCGAAACAAAATCTGATTTCTAACCAGTATATATCTCTTCTCTATCTCTAATCTAACTATTTAAAAAGAGAAAAT[G/A]
CATGAGAAAATAAAAACGGTTAAAATAACGTGTGAGGCAAAAGTCAAAAAAAAAGCGCAAAAGCACGCTAAAAATGTTCTCTATCATCAATAAAAAAATA

Reverse complement sequence

TATTTTTTTATTGATGATAGAGAACATTTTTAGCGTGCTTTTGCGCTTTTTTTTTGACTTTTGCCTCACACGTTATTTTAACCGTTTTTATTTTCTCATG[C/T]
ATTTTCTCTTTTTAAATAGTTAGATTAGAGATAGAGAAGAGATATATACTGGTTAGAAATCAGATTTTGTTTCGCCGTTTCTATTTTTTTCTCTCTTGCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.20% 1.90% 3.05% 15.76% NA
All Indica  2759 77.00% 0.20% 0.40% 22.36% NA
All Japonica  1512 86.00% 4.50% 7.80% 1.65% NA
Aus  269 57.20% 5.90% 3.72% 33.09% NA
Indica I  595 89.40% 0.20% 0.00% 10.42% NA
Indica II  465 87.30% 0.20% 1.29% 11.18% NA
Indica III  913 61.10% 0.10% 0.22% 38.55% NA
Indica Intermediate  786 80.00% 0.40% 0.38% 19.21% NA
Temperate Japonica  767 88.00% 5.60% 6.13% 0.26% NA
Tropical Japonica  504 84.90% 2.00% 8.93% 4.17% NA
Japonica Intermediate  241 82.20% 6.20% 10.79% 0.83% NA
VI/Aromatic  96 96.90% 0.00% 1.04% 2.08% NA
Intermediate  90 80.00% 2.20% 4.44% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216568179 G -> DEL N N silent_mutation Average:6.921; most accessible tissue: Zhenshan97 flag leaf, score: 11.736 N N N N
vg1216568179 G -> A LOC_Os12g28065.1 upstream_gene_variant ; 2237.0bp to feature; MODIFIER silent_mutation Average:6.921; most accessible tissue: Zhenshan97 flag leaf, score: 11.736 N N N N
vg1216568179 G -> A LOC_Os12g28070.1 downstream_gene_variant ; 3756.0bp to feature; MODIFIER silent_mutation Average:6.921; most accessible tissue: Zhenshan97 flag leaf, score: 11.736 N N N N
vg1216568179 G -> A LOC_Os12g28065-LOC_Os12g28070 intergenic_region ; MODIFIER silent_mutation Average:6.921; most accessible tissue: Zhenshan97 flag leaf, score: 11.736 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216568179 3.23E-08 NA mr1071_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216568179 8.85E-06 7.23E-08 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216568179 4.16E-06 NA mr1080_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216568179 NA 3.43E-06 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216568179 1.87E-07 NA mr1203_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216568179 NA 2.77E-07 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216568179 1.38E-07 NA mr1613_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216568179 NA 1.91E-07 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251