| Variant ID: vg1216568179 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16568179 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TGCAAGAGAGAAAAAAATAGAAACGGCGAAACAAAATCTGATTTCTAACCAGTATATATCTCTTCTCTATCTCTAATCTAACTATTTAAAAAGAGAAAAT[G/A]
CATGAGAAAATAAAAACGGTTAAAATAACGTGTGAGGCAAAAGTCAAAAAAAAAGCGCAAAAGCACGCTAAAAATGTTCTCTATCATCAATAAAAAAATA
TATTTTTTTATTGATGATAGAGAACATTTTTAGCGTGCTTTTGCGCTTTTTTTTTGACTTTTGCCTCACACGTTATTTTAACCGTTTTTATTTTCTCATG[C/T]
ATTTTCTCTTTTTAAATAGTTAGATTAGAGATAGAGAAGAGATATATACTGGTTAGAAATCAGATTTTGTTTCGCCGTTTCTATTTTTTTCTCTCTTGCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.20% | 1.90% | 3.05% | 15.76% | NA |
| All Indica | 2759 | 77.00% | 0.20% | 0.40% | 22.36% | NA |
| All Japonica | 1512 | 86.00% | 4.50% | 7.80% | 1.65% | NA |
| Aus | 269 | 57.20% | 5.90% | 3.72% | 33.09% | NA |
| Indica I | 595 | 89.40% | 0.20% | 0.00% | 10.42% | NA |
| Indica II | 465 | 87.30% | 0.20% | 1.29% | 11.18% | NA |
| Indica III | 913 | 61.10% | 0.10% | 0.22% | 38.55% | NA |
| Indica Intermediate | 786 | 80.00% | 0.40% | 0.38% | 19.21% | NA |
| Temperate Japonica | 767 | 88.00% | 5.60% | 6.13% | 0.26% | NA |
| Tropical Japonica | 504 | 84.90% | 2.00% | 8.93% | 4.17% | NA |
| Japonica Intermediate | 241 | 82.20% | 6.20% | 10.79% | 0.83% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 1.04% | 2.08% | NA |
| Intermediate | 90 | 80.00% | 2.20% | 4.44% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216568179 | G -> DEL | N | N | silent_mutation | Average:6.921; most accessible tissue: Zhenshan97 flag leaf, score: 11.736 | N | N | N | N |
| vg1216568179 | G -> A | LOC_Os12g28065.1 | upstream_gene_variant ; 2237.0bp to feature; MODIFIER | silent_mutation | Average:6.921; most accessible tissue: Zhenshan97 flag leaf, score: 11.736 | N | N | N | N |
| vg1216568179 | G -> A | LOC_Os12g28070.1 | downstream_gene_variant ; 3756.0bp to feature; MODIFIER | silent_mutation | Average:6.921; most accessible tissue: Zhenshan97 flag leaf, score: 11.736 | N | N | N | N |
| vg1216568179 | G -> A | LOC_Os12g28065-LOC_Os12g28070 | intergenic_region ; MODIFIER | silent_mutation | Average:6.921; most accessible tissue: Zhenshan97 flag leaf, score: 11.736 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216568179 | 3.23E-08 | NA | mr1071_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216568179 | 8.85E-06 | 7.23E-08 | mr1071_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216568179 | 4.16E-06 | NA | mr1080_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216568179 | NA | 3.43E-06 | mr1080_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216568179 | 1.87E-07 | NA | mr1203_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216568179 | NA | 2.77E-07 | mr1203_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216568179 | 1.38E-07 | NA | mr1613_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216568179 | NA | 1.91E-07 | mr1613_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |