Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1216567539:

Variant ID: vg1216567539 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16567539
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCTACTTGAGGTCTTTTTTGTTAAAAAATAATAAAAGTGAGAGAACAAAGGCAGAAAGGTGCATAAAAAGAAAAATAAAAGCCAAAAAAAAAGTCTGACT[T/C]
AGATTGGTGAAAAAAATTGATGTGCCGGATTGAAGATCTGTTTGCAAAAACGGAATCTATATGTCGAGAGCATTCCATTTTTATATGATTTTAATTTTTG

Reverse complement sequence

CAAAAATTAAAATCATATAAAAATGGAATGCTCTCGACATATAGATTCCGTTTTTGCAAACAGATCTTCAATCCGGCACATCAATTTTTTTCACCAATCT[A/G]
AGTCAGACTTTTTTTTTGGCTTTTATTTTTCTTTTTATGCACCTTTCTGCCTTTGTTCTCTCACTTTTATTATTTTTTAACAAAAAAGACCTCAAGTAGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.30% 7.00% 6.43% 14.28% NA
All Indica  2759 68.60% 3.90% 3.59% 23.85% NA
All Japonica  1512 83.70% 12.00% 4.10% 0.20% NA
Aus  269 48.00% 3.00% 47.96% 1.12% NA
Indica I  595 88.40% 0.00% 0.17% 11.43% NA
Indica II  465 70.30% 16.10% 11.18% 2.37% NA
Indica III  913 50.40% 0.50% 1.42% 47.65% NA
Indica Intermediate  786 73.90% 3.60% 4.20% 18.32% NA
Temperate Japonica  767 99.60% 0.10% 0.00% 0.26% NA
Tropical Japonica  504 54.60% 33.50% 11.71% 0.20% NA
Japonica Intermediate  241 94.20% 4.60% 1.24% 0.00% NA
VI/Aromatic  96 71.90% 17.70% 7.29% 3.12% NA
Intermediate  90 66.70% 16.70% 7.78% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216567539 T -> C LOC_Os12g28065.1 upstream_gene_variant ; 1597.0bp to feature; MODIFIER silent_mutation Average:6.929; most accessible tissue: Zhenshan97 flower, score: 13.891 N N N N
vg1216567539 T -> C LOC_Os12g28070.1 downstream_gene_variant ; 4396.0bp to feature; MODIFIER silent_mutation Average:6.929; most accessible tissue: Zhenshan97 flower, score: 13.891 N N N N
vg1216567539 T -> C LOC_Os12g28065-LOC_Os12g28070 intergenic_region ; MODIFIER silent_mutation Average:6.929; most accessible tissue: Zhenshan97 flower, score: 13.891 N N N N
vg1216567539 T -> DEL N N silent_mutation Average:6.929; most accessible tissue: Zhenshan97 flower, score: 13.891 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216567539 NA 4.80E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216567539 NA 6.94E-08 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216567539 1.40E-06 1.40E-06 mr1131 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216567539 6.55E-06 3.17E-07 mr1188 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216567539 NA 2.88E-06 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216567539 NA 9.40E-06 mr1227 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216567539 NA 8.72E-06 mr1235 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216567539 NA 5.25E-08 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216567539 4.38E-06 4.37E-06 mr1347 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216567539 NA 9.87E-07 mr1423 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216567539 NA 2.82E-07 mr1599 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216567539 NA 2.28E-08 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216567539 NA 9.99E-08 mr1075_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216567539 NA 5.93E-10 mr1077_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216567539 NA 1.37E-06 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216567539 NA 2.53E-06 mr1204_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216567539 NA 1.01E-06 mr1220_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216567539 NA 2.96E-06 mr1222_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216567539 8.48E-06 2.23E-08 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216567539 4.57E-06 9.21E-09 mr1248_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216567539 NA 9.06E-07 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216567539 NA 1.42E-08 mr1251_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216567539 NA 6.30E-06 mr1255_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216567539 NA 3.79E-07 mr1257_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216567539 NA 3.17E-06 mr1291_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216567539 2.15E-06 2.15E-06 mr1335_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216567539 5.43E-06 1.54E-09 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216567539 NA 1.31E-08 mr1435_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216567539 NA 7.28E-06 mr1479_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216567539 7.45E-06 7.45E-06 mr1547_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216567539 NA 3.07E-06 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216567539 1.92E-06 NA mr1600_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216567539 NA 1.15E-08 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216567539 NA 5.28E-06 mr1827_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216567539 NA 4.62E-06 mr1892_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216567539 NA 6.58E-07 mr1896_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251