\
| Variant ID: vg1216550375 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 16550375 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 111. )
TAATAGTAGTTCTAGTAAATATATTCAGTTATTGATTTGATGGCACTAATTTATAGTATTATAAATATTATTATATTTGTCTATAAACTTAGTCAAATTT[G/A]
AAATAGTTTAAGTTTAACCAAAGTCAAAACGTGTTGTAACCTGAAACAAAGGGAGTGGTATATATGAAGTATGGACAGAGCAACATGATCACCAAAACAC
GTGTTTTGGTGATCATGTTGCTCTGTCCATACTTCATATATACCACTCCCTTTGTTTCAGGTTACAACACGTTTTGACTTTGGTTAAACTTAAACTATTT[C/T]
AAATTTGACTAAGTTTATAGACAAATATAATAATATTTATAATACTATAAATTAGTGCCATCAAATCAATAACTGAATATATTTACTAGAACTACTATTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.50% | 25.60% | 1.04% | 3.87% | NA |
| All Indica | 2759 | 64.50% | 32.00% | 1.63% | 1.88% | NA |
| All Japonica | 1512 | 81.90% | 18.10% | 0.07% | 0.00% | NA |
| Aus | 269 | 49.80% | 1.10% | 0.74% | 48.33% | NA |
| Indica I | 595 | 38.20% | 55.80% | 4.37% | 1.68% | NA |
| Indica II | 465 | 58.90% | 38.70% | 0.86% | 1.51% | NA |
| Indica III | 913 | 85.80% | 12.90% | 0.44% | 0.88% | NA |
| Indica Intermediate | 786 | 63.10% | 32.10% | 1.40% | 3.44% | NA |
| Temperate Japonica | 767 | 99.30% | 0.50% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 50.40% | 49.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 92.10% | 7.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 74.00% | 25.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 68.90% | 30.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1216550375 | G -> DEL | N | N | silent_mutation | Average:35.606; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| vg1216550375 | G -> A | LOC_Os12g28050-LOC_Os12g28065 | intergenic_region ; MODIFIER | silent_mutation | Average:35.606; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1216550375 | NA | 3.03E-06 | mr1382 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216550375 | NA | 9.43E-07 | mr1471 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216550375 | NA | 2.35E-07 | mr1551 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216550375 | NA | 4.87E-09 | mr1696 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216550375 | NA | 3.82E-06 | mr1700 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216550375 | NA | 9.36E-07 | mr1925 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216550375 | 5.33E-06 | NA | mr1022_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216550375 | 2.88E-07 | NA | mr1023_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216550375 | NA | 5.33E-08 | mr1047_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216550375 | 7.21E-06 | NA | mr1055_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216550375 | 4.49E-08 | NA | mr1079_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216550375 | 2.46E-07 | NA | mr1132_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216550375 | NA | 7.87E-07 | mr1257_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216550375 | 1.87E-07 | NA | mr1390_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216550375 | 2.77E-07 | NA | mr1489_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216550375 | 2.31E-08 | NA | mr1490_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216550375 | NA | 7.91E-10 | mr1642_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216550375 | NA | 5.79E-06 | mr1782_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216550375 | NA | 5.66E-09 | mr1808_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216550375 | NA | 3.60E-06 | mr1815_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1216550375 | NA | 7.23E-06 | mr1892_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |