\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216542519:

Variant ID: vg1216542519 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16542519
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, T: 0.13, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


CGTTGCCTTGTATCTGTCATTGCTGGATTGGAGTGTTTCGATTTGTCCATTGTGTGTAATATTCAGATATATAACTAGTATATTTAAATTTTATATGAAA[T/C]
AATCAAGCTGAATGGAAACCAAATACCTACAGCAAGAAACAGTACATCTATGGAACGCGATGCACAAGCGCCGGCGGTGGCTAGACTTCGCGATCTGCTT

Reverse complement sequence

AAGCAGATCGCGAAGTCTAGCCACCGCCGGCGCTTGTGCATCGCGTTCCATAGATGTACTGTTTCTTGCTGTAGGTATTTGGTTTCCATTCAGCTTGATT[A/G]
TTTCATATAAAATTTAAATATACTAGTTATATATCTGAATATTACACACAATGGACAAATCGAAACACTCCAATCCAGCAATGACAGATACAAGGCAACG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.70% 25.10% 0.78% 38.38% NA
All Indica  2759 47.40% 2.40% 0.98% 49.22% NA
All Japonica  1512 10.80% 70.80% 0.20% 18.12% NA
Aus  269 40.90% 8.20% 0.37% 50.56% NA
Indica I  595 35.00% 1.30% 0.67% 63.03% NA
Indica II  465 18.30% 3.90% 2.15% 75.70% NA
Indica III  913 77.00% 0.30% 0.33% 22.34% NA
Indica Intermediate  786 39.60% 4.80% 1.27% 54.33% NA
Temperate Japonica  767 3.10% 95.80% 0.00% 1.04% NA
Tropical Japonica  504 21.40% 29.20% 0.60% 48.81% NA
Japonica Intermediate  241 13.30% 78.40% 0.00% 8.30% NA
VI/Aromatic  96 78.10% 0.00% 4.17% 17.71% NA
Intermediate  90 34.40% 31.10% 2.22% 32.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216542519 T -> C LOC_Os12g28040.1 upstream_gene_variant ; 2647.0bp to feature; MODIFIER silent_mutation Average:7.048; most accessible tissue: Callus, score: 29.889 N N N N
vg1216542519 T -> C LOC_Os12g28050.1 downstream_gene_variant ; 923.0bp to feature; MODIFIER silent_mutation Average:7.048; most accessible tissue: Callus, score: 29.889 N N N N
vg1216542519 T -> C LOC_Os12g28040-LOC_Os12g28050 intergenic_region ; MODIFIER silent_mutation Average:7.048; most accessible tissue: Callus, score: 29.889 N N N N
vg1216542519 T -> DEL N N silent_mutation Average:7.048; most accessible tissue: Callus, score: 29.889 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216542519 NA 1.87E-14 Grain_width Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1216542519 NA 6.74E-08 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216542519 NA 5.68E-07 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216542519 NA 4.22E-09 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216542519 NA 5.87E-07 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216542519 NA 3.97E-07 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216542519 NA 3.65E-06 mr1578 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216542519 NA 1.13E-09 mr1584 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216542519 NA 8.32E-07 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216542519 NA 1.38E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216542519 4.56E-07 2.71E-13 mr1002_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216542519 NA 2.93E-06 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216542519 NA 1.17E-09 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216542519 NA 2.69E-13 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216542519 NA 8.95E-06 mr1262_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216542519 NA 2.48E-07 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216542519 NA 5.76E-13 mr1368_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216542519 NA 9.68E-08 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216542519 NA 9.54E-11 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216542519 NA 5.39E-06 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216542519 NA 3.79E-07 mr1623_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216542519 NA 8.49E-07 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216542519 NA 1.28E-08 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216542519 NA 2.54E-08 mr1696_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216542519 NA 3.50E-06 mr1705_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216542519 NA 5.82E-07 mr1853_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216542519 NA 1.83E-06 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216542519 NA 9.02E-12 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251