\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216524318:

Variant ID: vg1216524318 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16524318
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.91, G: 0.08, others allele: 0.00, population size: 177. )

Flanking Sequence (100 bp) in Reference Genome:


TACTACTTCGGGTAAATAGGAAGCTCCTCTGAATTATTCGAACTCATACACACCGGCCACCAGAATGCAAGGCTAGTTCTAAATAGATTAATCAGCTTAG[G/A]
CCATCCTATACTAGCACATGTGGATGTACGAATAACTTTAAGTTGGTGACACAAGTTATGTCCTTATAGACTTGGGCAAACACTCCCCCTATCGGTATGC

Reverse complement sequence

GCATACCGATAGGGGGAGTGTTTGCCCAAGTCTATAAGGACATAACTTGTGTCACCAACTTAAAGTTATTCGTACATCCACATGTGCTAGTATAGGATGG[C/T]
CTAAGCTGATTAATCTATTTAGAACTAGCCTTGCATTCTGGTGGCCGGTGTGTATGAGTTCGAATAATTCAGAGGAGCTTCCTATTTACCCGAAGTAGTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.70% 25.50% 0.80% 38.02% NA
All Indica  2759 47.40% 3.00% 1.12% 48.50% NA
All Japonica  1512 11.00% 70.80% 0.00% 18.19% NA
Aus  269 40.10% 8.20% 1.86% 49.81% NA
Indica I  595 34.80% 3.00% 1.68% 60.50% NA
Indica II  465 18.70% 5.20% 1.08% 75.05% NA
Indica III  913 76.90% 0.30% 0.55% 22.23% NA
Indica Intermediate  786 39.70% 4.70% 1.40% 54.20% NA
Temperate Japonica  767 3.10% 95.80% 0.00% 1.04% NA
Tropical Japonica  504 22.00% 29.00% 0.00% 49.01% NA
Japonica Intermediate  241 13.30% 78.40% 0.00% 8.30% NA
VI/Aromatic  96 75.00% 0.00% 0.00% 25.00% NA
Intermediate  90 35.60% 33.30% 2.22% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216524318 G -> DEL N N silent_mutation Average:11.457; most accessible tissue: Callus, score: 48.79 N N N N
vg1216524318 G -> A LOC_Os12g28020.1 upstream_gene_variant ; 3454.0bp to feature; MODIFIER silent_mutation Average:11.457; most accessible tissue: Callus, score: 48.79 N N N N
vg1216524318 G -> A LOC_Os12g28015.1 downstream_gene_variant ; 3987.0bp to feature; MODIFIER silent_mutation Average:11.457; most accessible tissue: Callus, score: 48.79 N N N N
vg1216524318 G -> A LOC_Os12g28015-LOC_Os12g28020 intergenic_region ; MODIFIER silent_mutation Average:11.457; most accessible tissue: Callus, score: 48.79 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216524318 NA 2.28E-10 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216524318 NA 4.66E-06 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216524318 NA 9.16E-06 mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216524318 NA 2.63E-06 mr1790 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216524318 6.83E-06 8.46E-08 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216524318 9.90E-08 NA mr1079_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216524318 1.51E-07 NA mr1079_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216524318 4.71E-06 NA mr1132_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216524318 NA 5.44E-14 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216524318 2.86E-06 NA mr1390_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216524318 NA 1.27E-13 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216524318 4.85E-06 NA mr1489_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216524318 3.19E-07 NA mr1490_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216524318 NA 1.60E-13 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216524318 NA 2.74E-09 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251