\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216471161:

Variant ID: vg1216471161 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16471161
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:


AACAGCCCTACTCCCAGCGCACTCCCCTCTTATTATCTCCCGAGCCCGGCACGAGTGGTTGGTGGTGTCTCATACACGCGCGACAATAGCCGCTTGATGG[G/T]
TTATTGCTGGGCCACAACGCCCAAAATCTAGATCCATCGTTGGCCCGCTTGTGTCATTCAACAGAGCTCTCTTGCTATTTAAAAAATGAAACCGAGGTGT

Reverse complement sequence

ACACCTCGGTTTCATTTTTTAAATAGCAAGAGAGCTCTGTTGAATGACACAAGCGGGCCAACGATGGATCTAGATTTTGGGCGTTGTGGCCCAGCAATAA[C/A]
CCATCAAGCGGCTATTGTCGCGCGTGTATGAGACACCACCAACCACTCGTGCCGGGCTCGGGAGATAATAAGAGGGGAGTGCGCTGGGAGTAGGGCTGTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.30% 26.60% 7.30% 17.86% NA
All Indica  2759 30.00% 38.60% 10.58% 20.80% NA
All Japonica  1512 79.20% 9.40% 2.18% 9.26% NA
Aus  269 62.10% 8.90% 2.60% 26.39% NA
Indica I  595 8.40% 51.90% 25.21% 14.45% NA
Indica II  465 72.90% 12.00% 3.87% 11.18% NA
Indica III  913 14.10% 48.70% 5.91% 31.22% NA
Indica Intermediate  786 39.40% 32.40% 8.91% 19.21% NA
Temperate Japonica  767 91.00% 1.20% 1.17% 6.65% NA
Tropical Japonica  504 62.50% 22.40% 3.97% 11.11% NA
Japonica Intermediate  241 76.30% 8.30% 1.66% 13.69% NA
VI/Aromatic  96 30.20% 11.50% 4.17% 54.17% NA
Intermediate  90 66.70% 15.60% 10.00% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216471161 G -> DEL N N silent_mutation Average:51.185; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg1216471161 G -> T LOC_Os12g27940.1 downstream_gene_variant ; 1228.0bp to feature; MODIFIER silent_mutation Average:51.185; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg1216471161 G -> T LOC_Os12g27940-LOC_Os12g27950 intergenic_region ; MODIFIER silent_mutation Average:51.185; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216471161 4.97E-06 NA mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161 5.32E-07 NA mr1017 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161 5.22E-06 NA mr1018 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161 2.65E-07 1.13E-09 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161 NA 2.17E-07 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161 NA 5.29E-14 mr1032 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161 2.13E-07 NA mr1055 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161 9.40E-07 NA mr1132 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161 2.09E-06 NA mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161 NA 4.33E-15 mr1143 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161 3.21E-06 NA mr1178 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161 NA 1.03E-07 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161 NA 4.83E-07 mr1269 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161 1.08E-06 NA mr1390 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161 1.19E-06 NA mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161 NA 3.88E-09 mr1399 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161 NA 4.66E-14 mr1478 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161 3.74E-07 NA mr1490 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161 1.84E-06 NA mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161 NA 1.96E-14 mr1535 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161 NA 5.83E-07 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161 NA 5.09E-06 mr1698 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161 NA 9.62E-06 mr1734 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161 NA 1.59E-07 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161 NA 1.60E-08 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161 3.49E-06 NA mr1022_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161 2.41E-07 NA mr1055_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161 9.58E-07 NA mr1178_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251