Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216471161:

Variant ID: vg1216471161 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 16471161
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:

AACAGCCCTACTCCCAGCGCACTCCCCTCTTATTATCTCCCGAGCCCGGCACGAGTGGTTGGTGGTGTCTCATACACGCGCGACAATAGCCGCTTGATGG[G/T]
TTATTGCTGGGCCACAACGCCCAAAATCTAGATCCATCGTTGGCCCGCTTGTGTCATTCAACAGAGCTCTCTTGCTATTTAAAAAATGAAACCGAGGTGT

Reverse complement sequence

ACACCTCGGTTTCATTTTTTAAATAGCAAGAGAGCTCTGTTGAATGACACAAGCGGGCCAACGATGGATCTAGATTTTGGGCGTTGTGGCCCAGCAATAA[C/A]
CCATCAAGCGGCTATTGTCGCGCGTGTATGAGACACCACCAACCACTCGTGCCGGGCTCGGGAGATAATAAGAGGGGAGTGCGCTGGGAGTAGGGCTGTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.30%	26.60%	7.30%	17.86%	NA
All Indica	2759	30.00%	38.60%	10.58%	20.80%	NA
All Japonica	1512	79.20%	9.40%	2.18%	9.26%	NA
Aus	269	62.10%	8.90%	2.60%	26.39%	NA
Indica I	595	8.40%	51.90%	25.21%	14.45%	NA
Indica II	465	72.90%	12.00%	3.87%	11.18%	NA
Indica III	913	14.10%	48.70%	5.91%	31.22%	NA
Indica Intermediate	786	39.40%	32.40%	8.91%	19.21%	NA
Temperate Japonica	767	91.00%	1.20%	1.17%	6.65%	NA
Tropical Japonica	504	62.50%	22.40%	3.97%	11.11%	NA
Japonica Intermediate	241	76.30%	8.30%	1.66%	13.69%	NA
VI/Aromatic	96	30.20%	11.50%	4.17%	54.17%	NA
Intermediate	90	66.70%	15.60%	10.00%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216471161	G -> DEL	N	N	silent_mutation	Average:51.185; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg1216471161	G -> T	LOC_Os12g27940.1	downstream_gene_variant ; 1228.0bp to feature; MODIFIER	silent_mutation	Average:51.185; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg1216471161	G -> T	LOC_Os12g27940-LOC_Os12g27950	intergenic_region ; MODIFIER	silent_mutation	Average:51.185; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216471161	4.97E-06	NA	mr1016	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161	5.32E-07	NA	mr1017	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161	5.22E-06	NA	mr1018	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161	2.65E-07	1.13E-09	mr1018	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161	NA	2.17E-07	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161	NA	5.29E-14	mr1032	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161	2.13E-07	NA	mr1055	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161	9.40E-07	NA	mr1132	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161	2.09E-06	NA	mr1132	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161	NA	4.33E-15	mr1143	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161	3.21E-06	NA	mr1178	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161	NA	1.03E-07	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161	NA	4.83E-07	mr1269	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161	1.08E-06	NA	mr1390	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161	1.19E-06	NA	mr1390	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161	NA	3.88E-09	mr1399	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161	NA	4.66E-14	mr1478	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161	3.74E-07	NA	mr1490	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161	1.84E-06	NA	mr1490	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161	NA	1.96E-14	mr1535	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161	NA	5.83E-07	mr1625	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161	NA	5.09E-06	mr1698	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161	NA	9.62E-06	mr1734	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161	NA	1.59E-07	mr1796	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161	NA	1.60E-08	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161	3.49E-06	NA	mr1022_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161	2.41E-07	NA	mr1055_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216471161	9.58E-07	NA	mr1178_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251